Incidental Mutation 'R2119:Psmd1'
ID231250
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 1
SynonymsS1, P112
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.981) question?
Stock #R2119 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location86064387-86139151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86078700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 263 (S263T)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027432
AA Change: S263T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: S263T

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127104
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86090198 splice site probably benign
IGL02410:Psmd1 APN 1 86077437 missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86078580 missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86128192 missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86118521 missense possibly damaging 0.68
Rickety UTSW 1 86070628 critical splice donor site probably null
R0027:Psmd1 UTSW 1 86094265 splice site probably benign
R0115:Psmd1 UTSW 1 86083271 missense possibly damaging 0.89
R0201:Psmd1 UTSW 1 86118616 missense probably benign 0.11
R0206:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86078582 missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86094290 missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86082039 missense probably benign 0.03
R0790:Psmd1 UTSW 1 86077450 missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86091997 splice site probably benign
R1721:Psmd1 UTSW 1 86071845 missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86075997 missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86082101 splice site probably null
R2118:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86089997 missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3811:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3978:Psmd1 UTSW 1 86128187 missense probably benign 0.05
R4131:Psmd1 UTSW 1 86078700 missense probably damaging 0.98
R4360:Psmd1 UTSW 1 86133737 missense probably damaging 0.97
R4386:Psmd1 UTSW 1 86128192 missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86075951 missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86128204 missense probably benign 0.05
R4783:Psmd1 UTSW 1 86078712 missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86137098 missense probably benign 0.08
R4937:Psmd1 UTSW 1 86083225 missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86090183 missense probably damaging 0.99
R5486:Psmd1 UTSW 1 86137050 missense possibly damaging 0.59
R5979:Psmd1 UTSW 1 86090053 missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86137095 missense probably damaging 1.00
R6425:Psmd1 UTSW 1 86070628 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAATAGAATGCTAGGCTAGAGAC -3'
(R):5'- TGAAGATCCCACTGACTCCC -3'

Sequencing Primer
(F):5'- CCCTTGCAGATGAAGTTTTCAG -3'
(R):5'- TGACTCCCCAGATGAATACAGATGTG -3'
Posted On2014-09-18