Incidental Mutation 'R2119:Enah'
ID231255
Institutional Source Beutler Lab
Gene Symbol Enah
Ensembl Gene ENSMUSG00000022995
Gene NameENAH actin regulator
SynonymsNdpp1, Mena
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R2119 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location181896384-182019990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 181921753 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 138 (A138E)
Ref Sequence ENSEMBL: ENSMUSP00000141330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078719] [ENSMUST00000111024] [ENSMUST00000111025] [ENSMUST00000111030] [ENSMUST00000177811] [ENSMUST00000192967] [ENSMUST00000193074] [ENSMUST00000193703] [ENSMUST00000195059]
Predicted Effect probably damaging
Transcript: ENSMUST00000078719
AA Change: A507E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077781
Gene: ENSMUSG00000022995
AA Change: A507E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 154 258 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
low complexity region 308 317 N/A INTRINSIC
internal_repeat_1 354 366 4.73e-6 PROSPERO
low complexity region 373 392 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
low complexity region 430 471 N/A INTRINSIC
low complexity region 487 507 N/A INTRINSIC
low complexity region 542 609 N/A INTRINSIC
low complexity region 665 678 N/A INTRINSIC
internal_repeat_1 746 758 4.73e-6 PROSPERO
Pfam:VASP_tetra 765 801 1.7e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111024
AA Change: A244E
SMART Domains Protein: ENSMUSP00000106653
Gene: ENSMUSG00000022995
AA Change: A244E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111025
AA Change: A244E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106654
Gene: ENSMUSG00000022995
AA Change: A244E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 313 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
Pfam:VASP_tetra 467 506 2.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111030
AA Change: A492E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106659
Gene: ENSMUSG00000022995
AA Change: A492E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 3.87e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 3.87e-6 PROSPERO
Pfam:VASP_tetra 749 788 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177811
AA Change: A492E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136863
Gene: ENSMUSG00000022995
AA Change: A492E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 4.25e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 4.25e-6 PROSPERO
Pfam:VASP_tetra 749 788 2.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192967
AA Change: A138E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141330
Gene: ENSMUSG00000022995
AA Change: A138E

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 63 1e-3 SMART
low complexity region 70 99 N/A INTRINSIC
low complexity region 118 138 N/A INTRINSIC
low complexity region 173 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193074
SMART Domains Protein: ENSMUSP00000141936
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 7 127 1.5e-4 SMART
WH1 21 128 2.8e-47 SMART
coiled coil region 155 260 N/A INTRINSIC
low complexity region 262 329 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
Pfam:VASP_tetra 484 523 1.8e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000193703
AA Change: A244E
SMART Domains Protein: ENSMUSP00000141462
Gene: ENSMUSG00000022995
AA Change: A244E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 346 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
Pfam:VASP_tetra 501 540 2.5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195059
AA Change: A488E

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141344
Gene: ENSMUSG00000022995
AA Change: A488E

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted mutation show defects in major axonal projection pathways in brain, including malformation of the hippocampal commissure and pontocerebellar fibers and frequent agenesis of the corpus callosum due to a failure of axons to project across the midline during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Enah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Enah APN 1 181935696 intron probably benign
IGL01996:Enah APN 1 181956505 missense unknown
R0025:Enah UTSW 1 181913373 missense possibly damaging 0.53
R0612:Enah UTSW 1 181906448 splice site probably benign
R1005:Enah UTSW 1 181961930 splice site probably benign
R1075:Enah UTSW 1 181956501 missense unknown
R1589:Enah UTSW 1 181922293 missense probably damaging 1.00
R1601:Enah UTSW 1 181919620 nonsense probably null
R1607:Enah UTSW 1 181917197 critical splice donor site probably null
R1785:Enah UTSW 1 181956429 missense unknown
R2035:Enah UTSW 1 181921972 missense probably damaging 1.00
R2037:Enah UTSW 1 181921972 missense probably damaging 1.00
R2180:Enah UTSW 1 181918459 missense probably damaging 1.00
R2233:Enah UTSW 1 181921972 missense probably damaging 1.00
R4348:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4350:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4576:Enah UTSW 1 181919563 missense possibly damaging 0.79
R4956:Enah UTSW 1 181918289 missense probably damaging 0.98
R5230:Enah UTSW 1 181935670 intron probably benign
R5282:Enah UTSW 1 181935728 splice site probably null
R5505:Enah UTSW 1 181906453 splice site probably benign
R5813:Enah UTSW 1 181931185 intron probably benign
R6324:Enah UTSW 1 181918571 missense probably damaging 1.00
R6374:Enah UTSW 1 181923580 missense unknown
R6503:Enah UTSW 1 181918511 missense probably damaging 1.00
R6513:Enah UTSW 1 182014355 intron probably benign
R6925:Enah UTSW 1 181905898 critical splice acceptor site probably null
R6925:Enah UTSW 1 181905899 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTTCTAGGCAGGCAAAGTTG -3'
(R):5'- CTGTAACATACCCAGTGTCTCC -3'

Sequencing Primer
(F):5'- AGTTGCTCTGCACTCCTCAGAATG -3'
(R):5'- TACCTCAGGGCCAGCAG -3'
Posted On2014-09-18