Incidental Mutation 'R2119:Inpp5b'
ID231271
Institutional Source Beutler Lab
Gene Symbol Inpp5b
Ensembl Gene ENSMUSG00000028894
Gene Nameinositol polyphosphate-5-phosphatase B
Synonyms75kDa
MMRRC Submission 040123-MU
Accession Numbers

Ncbi RefSeq: NM_008385.3; MGI:103257

Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R2119 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location124741850-124801511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124797869 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 862 (H862Q)
Ref Sequence ENSEMBL: ENSMUSP00000092375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000094782] [ENSMUST00000106193] [ENSMUST00000138807] [ENSMUST00000175875] [ENSMUST00000184454]
PDB Structure
A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolism [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000030723
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094782
AA Change: H862Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092375
Gene: ENSMUSG00000028894
AA Change: H862Q

DomainStartEndE-ValueType
Pfam:INPP5B_PH 1 150 4.3e-61 PFAM
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
Blast:RhoGAP 706 732 1e-7 BLAST
Blast:RhoGAP 755 809 2e-24 BLAST
RhoGAP 827 993 6.77e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106193
SMART Domains Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135971
Predicted Effect probably benign
Transcript: ENSMUST00000138807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147452
Predicted Effect probably benign
Transcript: ENSMUST00000175875
Predicted Effect probably benign
Transcript: ENSMUST00000184454
SMART Domains Protein: ENSMUSP00000139221
Gene: ENSMUSG00000028894

DomainStartEndE-ValueType
PDB:2KIG|A 1 156 1e-105 PDB
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
PDB:3QBT|H 645 782 6e-49 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 2159609;2159620
FUNCTION: This gene encodes a member of the inositol polyphosphate-5-phosphatase (INPP5) family. This protein hydrolyzes the 5' phosphate from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol-1,4,5-trisphosphate, which results in changes to multiple signaling pathways. This protein may be involved in protein trafficking and secretion. Homozygous knockout mice exhibit impaired spermatogenesis and male sterility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null male mice are infertile with a disruption in spermatogenesis and a defect in adherens junctions processing. [provided by MGI curators]
Allele List at MGI

All alleles(24) : Targeted(6) Gene trapped(18)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Inpp5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Inpp5b APN 4 124784375 missense possibly damaging 0.94
IGL00696:Inpp5b APN 4 124742535 start codon destroyed probably null 1.00
IGL00969:Inpp5b APN 4 124783994 missense probably damaging 1.00
IGL01401:Inpp5b APN 4 124746087 missense probably damaging 0.97
IGL01481:Inpp5b APN 4 124800699 unclassified probably null
IGL01517:Inpp5b APN 4 124782436 missense probably benign 0.00
IGL03085:Inpp5b APN 4 124792322 missense probably benign 0.01
IGL03178:Inpp5b APN 4 124785254 missense probably benign 0.02
P0042:Inpp5b UTSW 4 124797910 critical splice donor site probably null
R0504:Inpp5b UTSW 4 124782408 nonsense probably null
R0531:Inpp5b UTSW 4 124795456 missense probably damaging 0.99
R1396:Inpp5b UTSW 4 124789080 missense probably damaging 1.00
R1626:Inpp5b UTSW 4 124783903 missense probably damaging 1.00
R1768:Inpp5b UTSW 4 124793276 nonsense probably null
R2037:Inpp5b UTSW 4 124798299 missense probably damaging 0.98
R2132:Inpp5b UTSW 4 124785168 splice site probably benign
R2190:Inpp5b UTSW 4 124785195 missense probably damaging 1.00
R3237:Inpp5b UTSW 4 124780486 missense probably benign 0.04
R3800:Inpp5b UTSW 4 124785345 missense probably damaging 1.00
R4735:Inpp5b UTSW 4 124783967 missense probably damaging 0.99
R4827:Inpp5b UTSW 4 124743850 intron probably benign
R4865:Inpp5b UTSW 4 124751495 missense probably benign
R4868:Inpp5b UTSW 4 124751410 missense probably damaging 0.99
R4913:Inpp5b UTSW 4 124780421 missense probably benign 0.09
R5055:Inpp5b UTSW 4 124743031 critical splice donor site probably null
R5068:Inpp5b UTSW 4 124742649 intron probably null
R5208:Inpp5b UTSW 4 124751317 missense possibly damaging 0.62
R5642:Inpp5b UTSW 4 124782436 missense probably benign 0.00
R5875:Inpp5b UTSW 4 124780406 missense possibly damaging 0.66
R6015:Inpp5b UTSW 4 124798350 missense possibly damaging 0.94
R6288:Inpp5b UTSW 4 124785227 missense probably benign 0.00
R6450:Inpp5b UTSW 4 124792252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAATGATTCAGAAGTCCC -3'
(R):5'- TGCCGTTTGTCAAGTGACCC -3'

Sequencing Primer
(F):5'- TGGAATGATTCAGAAGTCCCACTAC -3'
(R):5'- ACAGATGGAATGTCTTCTCTGGACAG -3'
Posted On2014-09-18