Incidental Mutation 'R2119:Klk1b21'
ID231285
Institutional Source Beutler Lab
Gene Symbol Klk1b21
Ensembl Gene ENSMUSG00000066516
Gene Namekallikrein 1-related peptidase b21
SynonymsKlk21, mGk-21
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2119 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44102328-44106583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44105769 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 163 (T163S)
Ref Sequence ENSEMBL: ENSMUSP00000082582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085455]
Predicted Effect probably benign
Transcript: ENSMUST00000085455
AA Change: T163S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082582
Gene: ENSMUSG00000066516
AA Change: T163S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 9.09e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Klk1b21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Klk1b21 APN 7 44105923 missense possibly damaging 0.81
IGL01710:Klk1b21 APN 7 44106495 missense probably benign 0.13
IGL02015:Klk1b21 APN 7 44104358 missense probably benign 0.41
R0138:Klk1b21 UTSW 7 44105895 missense probably damaging 1.00
R0384:Klk1b21 UTSW 7 44105493 missense probably benign 0.03
R1456:Klk1b21 UTSW 7 44105499 missense probably benign 0.01
R2021:Klk1b21 UTSW 7 44105994 nonsense probably null
R2265:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2267:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2269:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R5499:Klk1b21 UTSW 7 44105676 missense probably benign 0.07
R5623:Klk1b21 UTSW 7 44105565 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCCTCATGAATGACCAC -3'
(R):5'- GCACAAGTGTCTTTGCCTCC -3'

Sequencing Primer
(F):5'- ACACCCCACATCCTGAGG -3'
(R):5'- GCACACAGCATGACATCTGTG -3'
Posted On2014-09-18