Incidental Mutation 'R2119:Dlgap2'
ID231291
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2119 (G1)
Quality Score89
Status Not validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14778206 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 538 (A538V)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043279
AA Change: A537V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: A537V

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129119
Predicted Effect possibly damaging
Transcript: ENSMUST00000133298
AA Change: A537V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: A537V

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141214
Predicted Effect possibly damaging
Transcript: ENSMUST00000150247
AA Change: A537V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: A537V

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152652
AA Change: A538V

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: A538V

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATCCCCAGTCGCTAGCTATG -3'
(R):5'- CATCACGGGAATACATTCATCG -3'

Sequencing Primer
(F):5'- AGCTATGCACCTTCTGTTTTGTAAG -3'
(R):5'- CATTCATCGTCTTGGGAGTAACCAG -3'
Posted On2014-09-18