Incidental Mutation 'R2119:Rnf112'
ID231308
Institutional Source Beutler Lab
Gene Symbol Rnf112
Ensembl Gene ENSMUSG00000010086
Gene Namering finger protein 112
SynonymsZfp179, bfp
MMRRC Submission 040123-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R2119 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61448442-61454131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61451028 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 317 (V317I)
Ref Sequence ENSEMBL: ENSMUSP00000059903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054927
AA Change: V317I

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: V317I

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 423 1.3e-21 PFAM
low complexity region 541 557 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060255
AA Change: V317I

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: V317I

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 448 2.8e-21 PFAM
low complexity region 566 582 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102661
AA Change: V294I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: V294I

DomainStartEndE-ValueType
RING 57 97 1.7e-7 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:GBP 148 400 2.7e-19 PFAM
low complexity region 518 534 N/A INTRINSIC
transmembrane domain 547 569 N/A INTRINSIC
transmembrane domain 582 604 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Actbl2 G A 13: 111,255,160 V10I probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Aifm2 G A 10: 61,735,604 V306M possibly damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Atxn7l3 C A 11: 102,291,981 R278L possibly damaging Het
Bcl9 A G 3: 97,208,915 L821P probably benign Het
Cdh19 C T 1: 110,919,590 V430I probably benign Het
Clns1a T A 7: 97,713,904 probably null Het
Col3a1 T A 1: 45,346,121 C133S probably damaging Het
Csmd1 G A 8: 17,216,733 T59I probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Cyp2j8 A T 4: 96,507,201 D62E probably benign Het
Dcbld1 A T 10: 52,319,979 M428L probably benign Het
Dhx32 A T 7: 133,722,247 Y523* probably null Het
Dlgap2 C T 8: 14,778,206 A538V possibly damaging Het
Dlgap3 T C 4: 127,236,189 S919P probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsc1 A T 18: 20,110,152 H81Q probably benign Het
Dusp8 A T 7: 142,082,561 S431T possibly damaging Het
Dync1i1 A T 6: 5,767,096 T59S probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Eef1d G T 15: 75,903,213 A199E probably benign Het
Eml3 T A 19: 8,934,354 probably null Het
Enah G T 1: 181,921,753 A138E probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gba A T 3: 89,205,561 E170V probably benign Het
Hdac1 C T 4: 129,522,364 R212Q probably benign Het
Heatr1 T A 13: 12,432,646 L1740Q probably null Het
Inhbb T A 1: 119,420,701 H129L probably benign Het
Inpp5b T A 4: 124,797,869 H862Q probably benign Het
Itsn2 C A 12: 4,707,025 R1372S probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Klk1b21 A T 7: 44,105,769 T163S probably benign Het
Lmo3 A T 6: 138,416,494 C43S probably damaging Het
Metrn C T 17: 25,795,223 V210I probably benign Het
Ndufaf7 A T 17: 78,945,013 I284F possibly damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr713 A G 7: 107,036,731 D192G probably damaging Het
Osbpl7 T C 11: 97,056,079 S403P probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln T A 5: 22,019,000 E917V probably damaging Het
Rfc4 A T 16: 23,124,564 V61E probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Rtn4ip1 A G 10: 43,935,997 probably null Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Serhl A G 15: 83,115,575 Q252R probably benign Het
Sestd1 T C 2: 77,212,523 D229G probably benign Het
Slc35g1 T C 19: 38,403,287 V339A probably benign Het
Slc9b2 T A 3: 135,328,982 probably null Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tep1 T G 14: 50,838,986 K1664Q probably benign Het
Tmod2 T C 9: 75,586,095 K193E possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Ttc5 A T 14: 50,775,365 Y189N probably damaging Het
Ugt2a3 A T 5: 87,336,571 M198K probably damaging Het
Uox A G 3: 146,612,542 H66R probably benign Het
Usp9y A T Y: 1,303,451 D2487E probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Vps11 T C 9: 44,348,997 D856G probably benign Het
Zdhhc17 T C 10: 110,982,048 N90D possibly damaging Het
Zfp105 T A 9: 122,929,678 L138* probably null Het
Zfp28 A G 7: 6,394,876 Y770C probably benign Het
Zfp655 T A 5: 145,244,784 L484Q probably damaging Het
Zfp868 C A 8: 69,611,995 E230* probably null Het
Zfpm2 A G 15: 41,103,023 Y836C probably damaging Het
Other mutations in Rnf112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rnf112 APN 11 61452784 missense probably damaging 1.00
IGL01339:Rnf112 APN 11 61450477 missense probably benign 0.00
IGL01469:Rnf112 APN 11 61451341 missense possibly damaging 0.94
IGL02102:Rnf112 APN 11 61452015 missense probably benign 0.36
IGL02216:Rnf112 APN 11 61449978 missense probably damaging 1.00
IGL02431:Rnf112 APN 11 61450379 missense probably benign 0.17
IGL02638:Rnf112 APN 11 61449405 utr 3 prime probably benign
IGL02657:Rnf112 APN 11 61450252 splice site probably null
R0041:Rnf112 UTSW 11 61452355 missense probably damaging 1.00
R1514:Rnf112 UTSW 11 61450410 missense probably benign 0.01
R1991:Rnf112 UTSW 11 61452426 missense probably damaging 1.00
R2216:Rnf112 UTSW 11 61452279 missense probably damaging 1.00
R2880:Rnf112 UTSW 11 61450467 missense possibly damaging 0.89
R3775:Rnf112 UTSW 11 61450185 splice site probably benign
R3904:Rnf112 UTSW 11 61450385 missense probably damaging 1.00
R4646:Rnf112 UTSW 11 61452110 missense probably damaging 0.99
R4710:Rnf112 UTSW 11 61449831 missense probably damaging 1.00
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4894:Rnf112 UTSW 11 61452662 missense probably damaging 1.00
R4930:Rnf112 UTSW 11 61453465 missense probably benign
R4967:Rnf112 UTSW 11 61452926 splice site probably benign
R4992:Rnf112 UTSW 11 61452711 missense possibly damaging 0.72
R5547:Rnf112 UTSW 11 61451028 missense possibly damaging 0.94
R5874:Rnf112 UTSW 11 61449447 missense probably damaging 0.98
R5997:Rnf112 UTSW 11 61451022 missense possibly damaging 0.87
R6023:Rnf112 UTSW 11 61449729 missense probably damaging 1.00
R6906:Rnf112 UTSW 11 61450389 missense probably null 0.38
Predicted Primers PCR Primer
(F):5'- TGGAGTATGTCACCCACGTG -3'
(R):5'- AAATCATGGCTTCCCTTTCAGG -3'

Sequencing Primer
(F):5'- GCCCTTGCCCTGACTTATTATGATG -3'
(R):5'- CATGGCTTCCCTTTCAGGTTTAGAG -3'
Posted On2014-09-18