Incidental Mutation 'R2120:Rimbp2'
ID231364
Institutional Source Beutler Lab
Gene Symbol Rimbp2
Ensembl Gene ENSMUSG00000029420
Gene NameRIMS binding protein 2
Synonyms
MMRRC Submission 040124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2120 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location128757791-128953486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128788518 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 582 (S582P)
Ref Sequence ENSEMBL: ENSMUSP00000143276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111346] [ENSMUST00000196085] [ENSMUST00000198941] [ENSMUST00000199537] [ENSMUST00000200470]
Predicted Effect probably damaging
Transcript: ENSMUST00000111346
AA Change: S589P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106978
Gene: ENSMUSG00000029420
AA Change: S589P

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000196085
AA Change: S589P
SMART Domains Protein: ENSMUSP00000143725
Gene: ENSMUSG00000029420
AA Change: S589P

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1e-13 SMART
FN3 318 398 7.7e-4 SMART
FN3 412 484 1.7e-5 SMART
FN3 508 594 1.6e-4 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 699 720 N/A INTRINSIC
low complexity region 751 767 N/A INTRINSIC
SH3 803 867 3.2e-13 SMART
SH3 907 970 4.5e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198941
AA Change: S589P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142455
Gene: ENSMUSG00000029420
AA Change: S589P

DomainStartEndE-ValueType
coiled coil region 1 84 N/A INTRINSIC
low complexity region 178 187 N/A INTRINSIC
SH3 191 254 1.61e-11 SMART
FN3 318 398 1.52e-1 SMART
FN3 412 484 3.59e-3 SMART
FN3 508 594 3.08e-2 SMART
low complexity region 598 624 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
low complexity region 774 795 N/A INTRINSIC
low complexity region 826 842 N/A INTRINSIC
SH3 878 942 5.24e-11 SMART
SH3 982 1045 7.17e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199537
AA Change: S582P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143276
Gene: ENSMUSG00000029420
AA Change: S582P

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 1.61e-11 SMART
FN3 311 391 1.52e-1 SMART
FN3 405 477 3.59e-3 SMART
FN3 501 587 3.08e-2 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 5.24e-11 SMART
SH3 975 1038 7.17e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200470
AA Change: S582P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143099
Gene: ENSMUSG00000029420
AA Change: S582P

DomainStartEndE-ValueType
coiled coil region 1 77 N/A INTRINSIC
low complexity region 171 180 N/A INTRINSIC
SH3 184 247 9.8e-14 SMART
FN3 311 391 7.5e-4 SMART
FN3 405 477 1.7e-5 SMART
FN3 501 587 1.5e-4 SMART
low complexity region 591 617 N/A INTRINSIC
low complexity region 660 670 N/A INTRINSIC
low complexity region 767 788 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
SH3 871 935 3.2e-13 SMART
SH3 975 1038 4.4e-20 SMART
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
MGI Phenotype PHENOTYPE: Homozygous knockout results in a mild neurological phenotype with changes in the synaptic transmission and plasticity of hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actrt2 C T 4: 154,667,094 R195Q probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ankrd65 A G 4: 155,792,073 T239A probably benign Het
Ano7 G T 1: 93,402,133 probably benign Het
Apc A T 18: 34,276,601 E198V probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Atp9a A T 2: 168,653,537 V583E probably damaging Het
Bicral C T 17: 46,824,815 A490T probably benign Het
C1rl C T 6: 124,508,713 P348S probably damaging Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Cx3cr1 T A 9: 120,051,683 T218S probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dmd G C X: 84,312,483 A2257P probably benign Het
E2f4 A G 8: 105,300,341 Y179C probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Endod1 T C 9: 14,357,653 N179D probably benign Het
Epc2 C T 2: 49,547,609 probably benign Het
Ets2 G T 16: 95,718,933 R401L probably benign Het
Fgd4 C T 16: 16,425,828 C614Y probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Frem3 A T 8: 80,615,457 T1460S probably benign Het
H2-M1 T G 17: 36,670,037 T336P possibly damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ipo7 G T 7: 110,049,631 D704Y probably damaging Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Jarid2 G T 13: 44,906,336 M681I probably benign Het
Kif4-ps T C 12: 101,147,697 L695P probably damaging Het
Kmt2d A G 15: 98,839,529 probably benign Het
Krt25 T C 11: 99,321,197 T205A probably benign Het
Lif T C 11: 4,269,051 V110A possibly damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Man2b1 A G 8: 85,093,024 probably benign Het
Med16 A T 10: 79,903,082 M290K possibly damaging Het
Mov10l1 C A 15: 89,007,627 Q562K probably benign Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Mtmr6 T C 14: 60,296,659 F449L probably damaging Het
Myt1l A T 12: 29,783,619 probably null Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1054 G A 2: 86,333,345 R4C probably benign Het
Olfr1280 A G 2: 111,315,499 T7A probably benign Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr743 T C 14: 50,533,946 I178T probably damaging Het
Patj T A 4: 98,456,225 D591E probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Pitpnm2 G A 5: 124,127,269 P757L probably damaging Het
Plcd4 A G 1: 74,564,425 T662A probably benign Het
Podn C T 4: 108,023,361 A31T probably damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rab3gap2 A T 1: 185,261,367 D782V possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln G A 5: 21,969,085 H2007Y probably damaging Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sars T C 3: 108,434,156 I114V probably benign Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sec14l1 C T 11: 117,148,532 probably benign Het
Serpinb8 A G 1: 107,605,887 E224G probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Srgn T A 10: 62,507,634 probably benign Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tada3 T C 6: 113,371,015 I263V possibly damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r115 T A 6: 132,737,507 R160S possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Trp53bp2 A G 1: 182,441,639 M223V probably benign Het
Ttc21b C T 2: 66,226,754 V625I probably benign Het
Txnrd1 T A 10: 82,887,233 C421S possibly damaging Het
Unc45a T C 7: 80,340,098 T8A probably benign Het
Usp6nl T A 2: 6,440,937 V552E probably damaging Het
Vmn2r115 T G 17: 23,359,323 L590R probably damaging Het
Vmn2r88 A T 14: 51,413,208 H126L probably benign Het
Vps13c A G 9: 67,919,334 D1419G possibly damaging Het
Vwa3a A G 7: 120,792,418 T776A probably benign Het
Zfp580 T C 7: 5,053,009 Y123H probably damaging Het
Other mutations in Rimbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Rimbp2 APN 5 128806441 missense probably benign 0.00
IGL01321:Rimbp2 APN 5 128786752 missense probably benign 0.10
IGL01459:Rimbp2 APN 5 128788211 critical splice donor site probably null
IGL01743:Rimbp2 APN 5 128797848 splice site probably benign
IGL01975:Rimbp2 APN 5 128797648 missense probably benign 0.30
IGL02269:Rimbp2 APN 5 128774295 missense probably damaging 1.00
IGL02341:Rimbp2 APN 5 128800961 nonsense probably null
IGL02368:Rimbp2 APN 5 128788154 splice site probably null
IGL02392:Rimbp2 APN 5 128771797 missense probably benign 0.01
IGL03156:Rimbp2 APN 5 128771757 missense probably damaging 1.00
IGL02837:Rimbp2 UTSW 5 128797745 missense probably damaging 0.98
R0193:Rimbp2 UTSW 5 128788356 missense probably benign 0.12
R0376:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0377:Rimbp2 UTSW 5 128803861 missense probably damaging 0.98
R0661:Rimbp2 UTSW 5 128786710 missense probably benign 0.20
R1217:Rimbp2 UTSW 5 128788287 missense probably benign 0.04
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1376:Rimbp2 UTSW 5 128770291 missense possibly damaging 0.75
R1551:Rimbp2 UTSW 5 128806359 missense probably damaging 0.97
R1883:Rimbp2 UTSW 5 128803934 missense possibly damaging 0.93
R1970:Rimbp2 UTSW 5 128797241 missense probably damaging 1.00
R2111:Rimbp2 UTSW 5 128773501 missense probably damaging 1.00
R2155:Rimbp2 UTSW 5 128788165 missense probably damaging 0.99
R2332:Rimbp2 UTSW 5 128789641 missense probably benign 0.42
R2370:Rimbp2 UTSW 5 128803844 missense probably damaging 0.99
R2402:Rimbp2 UTSW 5 128784888 missense probably damaging 1.00
R3710:Rimbp2 UTSW 5 128789731 missense probably benign 0.16
R3877:Rimbp2 UTSW 5 128773465 missense probably damaging 1.00
R3974:Rimbp2 UTSW 5 128797798 missense probably damaging 1.00
R4257:Rimbp2 UTSW 5 128774260 missense probably damaging 1.00
R4270:Rimbp2 UTSW 5 128819777 missense probably benign
R4271:Rimbp2 UTSW 5 128819777 missense probably benign
R4281:Rimbp2 UTSW 5 128788340 missense possibly damaging 0.82
R4934:Rimbp2 UTSW 5 128788515 missense probably benign 0.12
R5011:Rimbp2 UTSW 5 128803921 missense probably damaging 0.98
R5173:Rimbp2 UTSW 5 128797648 missense probably benign 0.30
R5288:Rimbp2 UTSW 5 128788592 missense probably benign 0.00
R5305:Rimbp2 UTSW 5 128797381 missense possibly damaging 0.69
R5554:Rimbp2 UTSW 5 128780342 missense probably damaging 0.98
R6189:Rimbp2 UTSW 5 128803897 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTCAGGTGGTTCCAAC -3'
(R):5'- ATGCATCTGCCTTCAAGAGATG -3'

Sequencing Primer
(F):5'- CATGTCAGGTGGTTCCAACATGTG -3'
(R):5'- ATGCCACAGCTGGGTTATGAC -3'
Posted On2014-09-18