Incidental Mutation 'R2120:Vps13c'
ID231389
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 040124-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R2120 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67919334 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1419 (D1419G)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077879
AA Change: D1419G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: D1419G

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actrt2 C T 4: 154,667,094 R195Q probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ankrd65 A G 4: 155,792,073 T239A probably benign Het
Ano7 G T 1: 93,402,133 probably benign Het
Apc A T 18: 34,276,601 E198V probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Atp9a A T 2: 168,653,537 V583E probably damaging Het
Bicral C T 17: 46,824,815 A490T probably benign Het
C1rl C T 6: 124,508,713 P348S probably damaging Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Cx3cr1 T A 9: 120,051,683 T218S probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dmd G C X: 84,312,483 A2257P probably benign Het
E2f4 A G 8: 105,300,341 Y179C probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Endod1 T C 9: 14,357,653 N179D probably benign Het
Epc2 C T 2: 49,547,609 probably benign Het
Ets2 G T 16: 95,718,933 R401L probably benign Het
Fgd4 C T 16: 16,425,828 C614Y probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Frem3 A T 8: 80,615,457 T1460S probably benign Het
H2-M1 T G 17: 36,670,037 T336P possibly damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ipo7 G T 7: 110,049,631 D704Y probably damaging Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Jarid2 G T 13: 44,906,336 M681I probably benign Het
Kif4-ps T C 12: 101,147,697 L695P probably damaging Het
Kmt2d A G 15: 98,839,529 probably benign Het
Krt25 T C 11: 99,321,197 T205A probably benign Het
Lif T C 11: 4,269,051 V110A possibly damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Man2b1 A G 8: 85,093,024 probably benign Het
Med16 A T 10: 79,903,082 M290K possibly damaging Het
Mov10l1 C A 15: 89,007,627 Q562K probably benign Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Mtmr6 T C 14: 60,296,659 F449L probably damaging Het
Myt1l A T 12: 29,783,619 probably null Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1054 G A 2: 86,333,345 R4C probably benign Het
Olfr1280 A G 2: 111,315,499 T7A probably benign Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr743 T C 14: 50,533,946 I178T probably damaging Het
Patj T A 4: 98,456,225 D591E probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Pitpnm2 G A 5: 124,127,269 P757L probably damaging Het
Plcd4 A G 1: 74,564,425 T662A probably benign Het
Podn C T 4: 108,023,361 A31T probably damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rab3gap2 A T 1: 185,261,367 D782V possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln G A 5: 21,969,085 H2007Y probably damaging Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Rimbp2 A G 5: 128,788,518 S582P probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sars T C 3: 108,434,156 I114V probably benign Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sec14l1 C T 11: 117,148,532 probably benign Het
Serpinb8 A G 1: 107,605,887 E224G probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Srgn T A 10: 62,507,634 probably benign Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tada3 T C 6: 113,371,015 I263V possibly damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r115 T A 6: 132,737,507 R160S possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Trp53bp2 A G 1: 182,441,639 M223V probably benign Het
Ttc21b C T 2: 66,226,754 V625I probably benign Het
Txnrd1 T A 10: 82,887,233 C421S possibly damaging Het
Unc45a T C 7: 80,340,098 T8A probably benign Het
Usp6nl T A 2: 6,440,937 V552E probably damaging Het
Vmn2r115 T G 17: 23,359,323 L590R probably damaging Het
Vmn2r88 A T 14: 51,413,208 H126L probably benign Het
Vwa3a A G 7: 120,792,418 T776A probably benign Het
Zfp580 T C 7: 5,053,009 Y123H probably damaging Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCATACAAGTTTGCAGC -3'
(R):5'- AGCAAGTTACATGAATTGCTTCC -3'

Sequencing Primer
(F):5'- GCTCATACAAGTTTGCAGCAAGTATC -3'
(R):5'- GAACTAGATCCCTAAAATGTAACTGG -3'
Posted On2014-09-18