Incidental Mutation 'R2120:Olfr743'
ID231406
Institutional Source Beutler Lab
Gene Symbol Olfr743
Ensembl Gene ENSMUSG00000094285
Gene Nameolfactory receptor 743
SynonymsOlfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1
MMRRC Submission 040124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2120 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50521839-50534955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50533946 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 178 (I178T)
Ref Sequence ENSEMBL: ENSMUSP00000150946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]
Predicted Effect probably damaging
Transcript: ENSMUST00000071294
AA Change: I178T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: I178T

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.6e-56 PFAM
Pfam:7tm_1 45 294 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215793
AA Change: I178T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actrt2 C T 4: 154,667,094 R195Q probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ankrd65 A G 4: 155,792,073 T239A probably benign Het
Ano7 G T 1: 93,402,133 probably benign Het
Apc A T 18: 34,276,601 E198V probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Atp9a A T 2: 168,653,537 V583E probably damaging Het
Bicral C T 17: 46,824,815 A490T probably benign Het
C1rl C T 6: 124,508,713 P348S probably damaging Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Cx3cr1 T A 9: 120,051,683 T218S probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dmd G C X: 84,312,483 A2257P probably benign Het
E2f4 A G 8: 105,300,341 Y179C probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Endod1 T C 9: 14,357,653 N179D probably benign Het
Epc2 C T 2: 49,547,609 probably benign Het
Ets2 G T 16: 95,718,933 R401L probably benign Het
Fgd4 C T 16: 16,425,828 C614Y probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Frem3 A T 8: 80,615,457 T1460S probably benign Het
H2-M1 T G 17: 36,670,037 T336P possibly damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ipo7 G T 7: 110,049,631 D704Y probably damaging Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Jarid2 G T 13: 44,906,336 M681I probably benign Het
Kif4-ps T C 12: 101,147,697 L695P probably damaging Het
Kmt2d A G 15: 98,839,529 probably benign Het
Krt25 T C 11: 99,321,197 T205A probably benign Het
Lif T C 11: 4,269,051 V110A possibly damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Man2b1 A G 8: 85,093,024 probably benign Het
Med16 A T 10: 79,903,082 M290K possibly damaging Het
Mov10l1 C A 15: 89,007,627 Q562K probably benign Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Mtmr6 T C 14: 60,296,659 F449L probably damaging Het
Myt1l A T 12: 29,783,619 probably null Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1054 G A 2: 86,333,345 R4C probably benign Het
Olfr1280 A G 2: 111,315,499 T7A probably benign Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Patj T A 4: 98,456,225 D591E probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Pitpnm2 G A 5: 124,127,269 P757L probably damaging Het
Plcd4 A G 1: 74,564,425 T662A probably benign Het
Podn C T 4: 108,023,361 A31T probably damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rab3gap2 A T 1: 185,261,367 D782V possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln G A 5: 21,969,085 H2007Y probably damaging Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Rimbp2 A G 5: 128,788,518 S582P probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sars T C 3: 108,434,156 I114V probably benign Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sec14l1 C T 11: 117,148,532 probably benign Het
Serpinb8 A G 1: 107,605,887 E224G probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Srgn T A 10: 62,507,634 probably benign Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tada3 T C 6: 113,371,015 I263V possibly damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r115 T A 6: 132,737,507 R160S possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Trp53bp2 A G 1: 182,441,639 M223V probably benign Het
Ttc21b C T 2: 66,226,754 V625I probably benign Het
Txnrd1 T A 10: 82,887,233 C421S possibly damaging Het
Unc45a T C 7: 80,340,098 T8A probably benign Het
Usp6nl T A 2: 6,440,937 V552E probably damaging Het
Vmn2r115 T G 17: 23,359,323 L590R probably damaging Het
Vmn2r88 A T 14: 51,413,208 H126L probably benign Het
Vps13c A G 9: 67,919,334 D1419G possibly damaging Het
Vwa3a A G 7: 120,792,418 T776A probably benign Het
Zfp580 T C 7: 5,053,009 Y123H probably damaging Het
Other mutations in Olfr743
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr743 APN 14 50533949 missense probably damaging 1.00
IGL01551:Olfr743 APN 14 50534161 missense probably benign
IGL02024:Olfr743 APN 14 50533850 missense probably benign 0.00
IGL02867:Olfr743 APN 14 50533513 missense probably benign
IGL02889:Olfr743 APN 14 50533513 missense probably benign
IGL03195:Olfr743 APN 14 50533420 missense probably benign
IGL03296:Olfr743 APN 14 50533945 missense possibly damaging 0.90
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0102:Olfr743 UTSW 14 50533631 missense probably damaging 1.00
R0556:Olfr743 UTSW 14 50533924 missense probably benign 0.01
R0626:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0661:Olfr743 UTSW 14 50534095 missense probably benign
R0759:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0761:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0894:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1109:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1110:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1312:Olfr743 UTSW 14 50534195 missense probably benign
R1446:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1502:Olfr743 UTSW 14 50533777 missense possibly damaging 0.47
R1518:Olfr743 UTSW 14 50534165 missense probably damaging 1.00
R1529:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1624:Olfr743 UTSW 14 50533643 missense probably damaging 1.00
R1646:Olfr743 UTSW 14 50533583 missense probably benign 0.01
R1687:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1795:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R2011:Olfr743 UTSW 14 50533684 missense probably damaging 1.00
R2697:Olfr743 UTSW 14 50533781 missense probably damaging 1.00
R2857:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R2858:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R3906:Olfr743 UTSW 14 50533754 missense probably benign 0.03
R4327:Olfr743 UTSW 14 50533514 missense probably benign 0.05
R4355:Olfr743 UTSW 14 50533759 missense possibly damaging 0.94
R4663:Olfr743 UTSW 14 50533604 missense probably damaging 1.00
R5214:Olfr743 UTSW 14 50534347 makesense probably null
R5964:Olfr743 UTSW 14 50534198 missense probably damaging 0.99
R6148:Olfr743 UTSW 14 50534321 missense probably benign 0.00
R6167:Olfr743 UTSW 14 50534155 missense probably damaging 1.00
R6301:Olfr743 UTSW 14 50534254 missense probably benign 0.02
R6616:Olfr743 UTSW 14 50533907 missense probably benign 0.43
R6910:Olfr743 UTSW 14 50533873 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGTCATGGCATTTGATCGATACC -3'
(R):5'- GAGAAACCACAGTCACATGTG -3'

Sequencing Primer
(F):5'- GATCGATACCTTGCCATCTGTAGG -3'
(R):5'- TTGTCCATCTCTTGAAGGAAGTC -3'
Posted On2014-09-18