Incidental Mutation 'R2120:Ltbp1'
ID231418
Institutional Source Beutler Lab
Gene Symbol Ltbp1
Ensembl Gene ENSMUSG00000001870
Gene Namelatent transforming growth factor beta binding protein 1
Synonymsb2b1000Clo, LTBP-1, 9430031G15Rik
MMRRC Submission 040124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2120 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location75005568-75392512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75310159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1031 (V1031E)
Ref Sequence ENSEMBL: ENSMUSP00000001927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001927
AA Change: V1031E

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870
AA Change: V1031E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 34 49 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
EGF 184 213 9.27e-1 SMART
EGF 394 423 2.23e-3 SMART
Pfam:TB 559 601 2.4e-9 PFAM
EGF_CA 618 658 9.39e-11 SMART
Pfam:TB 680 720 1e-18 PFAM
low complexity region 839 849 N/A INTRINSIC
EGF_CA 865 906 5.83e-7 SMART
EGF_CA 907 948 6.39e-13 SMART
EGF_CA 949 989 4.25e-9 SMART
EGF_CA 990 1029 2.44e-9 SMART
EGF_CA 1030 1070 5.87e-12 SMART
EGF_CA 1071 1111 3.61e-12 SMART
EGF_CA 1112 1152 1.57e-12 SMART
EGF_CA 1153 1193 1.75e-10 SMART
EGF_CA 1194 1235 6.74e-12 SMART
EGF_CA 1236 1277 3.22e-9 SMART
EGF 1281 1320 2.16e1 SMART
Pfam:TB 1349 1391 5.6e-17 PFAM
EGF 1418 1457 1.14e0 SMART
EGF_CA 1458 1498 2.68e-6 SMART
Pfam:TB 1526 1567 4.2e-15 PFAM
EGF 1615 1652 1e-5 SMART
EGF_CA 1653 1697 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112514
AA Change: V660E

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870
AA Change: V660E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.5e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 400 3.1e-17 PFAM
low complexity region 468 478 N/A INTRINSIC
EGF_CA 494 535 5.83e-7 SMART
EGF_CA 536 577 6.39e-13 SMART
EGF_CA 578 618 4.25e-9 SMART
EGF_CA 619 658 2.44e-9 SMART
EGF_CA 659 699 5.87e-12 SMART
EGF_CA 700 740 3.61e-12 SMART
EGF_CA 741 781 1.57e-12 SMART
EGF_CA 782 822 1.75e-10 SMART
EGF_CA 823 864 6.74e-12 SMART
EGF_CA 865 906 3.22e-9 SMART
EGF 910 949 2.16e1 SMART
Pfam:TB 977 1020 4.3e-20 PFAM
EGF 1047 1086 1.14e0 SMART
EGF_CA 1087 1127 2.68e-6 SMART
Pfam:TB 1154 1196 1.3e-17 PFAM
EGF 1244 1281 1e-5 SMART
EGF_CA 1282 1326 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112516
AA Change: V713E

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870
AA Change: V713E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.9e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 402 7.6e-20 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 5.83e-7 SMART
EGF_CA 589 630 6.39e-13 SMART
EGF_CA 631 671 4.25e-9 SMART
EGF_CA 672 711 2.44e-9 SMART
EGF_CA 712 752 5.87e-12 SMART
EGF_CA 753 793 3.61e-12 SMART
EGF_CA 794 834 1.57e-12 SMART
EGF_CA 835 875 1.75e-10 SMART
EGF_CA 876 917 6.74e-12 SMART
EGF_CA 918 959 3.22e-9 SMART
EGF 963 1002 2.16e1 SMART
Pfam:TB 1030 1073 4.5e-20 PFAM
EGF 1100 1139 1.14e0 SMART
EGF_CA 1140 1180 2.68e-6 SMART
Pfam:TB 1207 1249 1.4e-17 PFAM
EGF 1297 1334 1e-5 SMART
EGF_CA 1335 1379 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135447
AA Change: V713E

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870
AA Change: V713E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 1.1e-5 SMART
Pfam:TB 240 283 4.3e-10 PFAM
EGF_CA 300 340 4.4e-13 SMART
Pfam:TB 361 402 3.3e-17 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 2.9e-9 SMART
EGF_CA 589 630 3e-15 SMART
EGF_CA 631 671 2.1e-11 SMART
EGF_CA 672 711 1.2e-11 SMART
EGF_CA 712 752 2.8e-14 SMART
EGF_CA 753 793 1.8e-14 SMART
EGF_CA 794 834 7.5e-15 SMART
EGF_CA 835 875 8.4e-13 SMART
EGF_CA 876 917 3.2e-14 SMART
EGF_CA 918 959 1.6e-11 SMART
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actrt2 C T 4: 154,667,094 R195Q probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ankrd65 A G 4: 155,792,073 T239A probably benign Het
Ano7 G T 1: 93,402,133 probably benign Het
Apc A T 18: 34,276,601 E198V probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Atp9a A T 2: 168,653,537 V583E probably damaging Het
Bicral C T 17: 46,824,815 A490T probably benign Het
C1rl C T 6: 124,508,713 P348S probably damaging Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Cx3cr1 T A 9: 120,051,683 T218S probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dmd G C X: 84,312,483 A2257P probably benign Het
E2f4 A G 8: 105,300,341 Y179C probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Endod1 T C 9: 14,357,653 N179D probably benign Het
Epc2 C T 2: 49,547,609 probably benign Het
Ets2 G T 16: 95,718,933 R401L probably benign Het
Fgd4 C T 16: 16,425,828 C614Y probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Frem3 A T 8: 80,615,457 T1460S probably benign Het
H2-M1 T G 17: 36,670,037 T336P possibly damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ipo7 G T 7: 110,049,631 D704Y probably damaging Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Jarid2 G T 13: 44,906,336 M681I probably benign Het
Kif4-ps T C 12: 101,147,697 L695P probably damaging Het
Kmt2d A G 15: 98,839,529 probably benign Het
Krt25 T C 11: 99,321,197 T205A probably benign Het
Lif T C 11: 4,269,051 V110A possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Man2b1 A G 8: 85,093,024 probably benign Het
Med16 A T 10: 79,903,082 M290K possibly damaging Het
Mov10l1 C A 15: 89,007,627 Q562K probably benign Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Mtmr6 T C 14: 60,296,659 F449L probably damaging Het
Myt1l A T 12: 29,783,619 probably null Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1054 G A 2: 86,333,345 R4C probably benign Het
Olfr1280 A G 2: 111,315,499 T7A probably benign Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr743 T C 14: 50,533,946 I178T probably damaging Het
Patj T A 4: 98,456,225 D591E probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Pitpnm2 G A 5: 124,127,269 P757L probably damaging Het
Plcd4 A G 1: 74,564,425 T662A probably benign Het
Podn C T 4: 108,023,361 A31T probably damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rab3gap2 A T 1: 185,261,367 D782V possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln G A 5: 21,969,085 H2007Y probably damaging Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Rimbp2 A G 5: 128,788,518 S582P probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sars T C 3: 108,434,156 I114V probably benign Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sec14l1 C T 11: 117,148,532 probably benign Het
Serpinb8 A G 1: 107,605,887 E224G probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Srgn T A 10: 62,507,634 probably benign Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tada3 T C 6: 113,371,015 I263V possibly damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r115 T A 6: 132,737,507 R160S possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Trp53bp2 A G 1: 182,441,639 M223V probably benign Het
Ttc21b C T 2: 66,226,754 V625I probably benign Het
Txnrd1 T A 10: 82,887,233 C421S possibly damaging Het
Unc45a T C 7: 80,340,098 T8A probably benign Het
Usp6nl T A 2: 6,440,937 V552E probably damaging Het
Vmn2r115 T G 17: 23,359,323 L590R probably damaging Het
Vmn2r88 A T 14: 51,413,208 H126L probably benign Het
Vps13c A G 9: 67,919,334 D1419G possibly damaging Het
Vwa3a A G 7: 120,792,418 T776A probably benign Het
Zfp580 T C 7: 5,053,009 Y123H probably damaging Het
Other mutations in Ltbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ltbp1 APN 17 75225338 missense probably damaging 1.00
IGL00156:Ltbp1 APN 17 75385160 missense probably damaging 0.97
IGL00161:Ltbp1 APN 17 75310152 splice site probably benign
IGL00771:Ltbp1 APN 17 75362516 missense probably damaging 1.00
IGL00822:Ltbp1 APN 17 75151321 missense probably damaging 1.00
IGL01760:Ltbp1 APN 17 75227150 missense probably damaging 0.97
IGL01796:Ltbp1 APN 17 75227245 splice site probably benign
IGL01826:Ltbp1 APN 17 75292840 missense possibly damaging 0.67
IGL02372:Ltbp1 APN 17 75252406 missense probably damaging 0.99
IGL02792:Ltbp1 APN 17 75282994 missense probably damaging 1.00
IGL02862:Ltbp1 APN 17 75390471 missense probably damaging 1.00
IGL03095:Ltbp1 APN 17 75282418 missense possibly damaging 0.67
IGL03345:Ltbp1 APN 17 75066159 missense probably damaging 0.99
IGL03404:Ltbp1 APN 17 75225306 missense probably damaging 0.97
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0034:Ltbp1 UTSW 17 75047568 intron probably benign
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0467:Ltbp1 UTSW 17 75282429 critical splice donor site probably null
R0554:Ltbp1 UTSW 17 75225279 missense probably damaging 0.99
R0584:Ltbp1 UTSW 17 75363472 missense probably damaging 1.00
R0863:Ltbp1 UTSW 17 75252386 missense probably damaging 1.00
R0991:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1084:Ltbp1 UTSW 17 75359425 nonsense probably null
R1114:Ltbp1 UTSW 17 75360775 missense probably benign
R1177:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1179:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1245:Ltbp1 UTSW 17 75327194 splice site probably benign
R1246:Ltbp1 UTSW 17 75385161 nonsense probably null
R1258:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1259:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1260:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1262:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1265:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1267:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1269:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1272:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1411:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1579:Ltbp1 UTSW 17 75252367 missense probably benign 0.00
R1694:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1705:Ltbp1 UTSW 17 75385201 splice site probably null
R1716:Ltbp1 UTSW 17 75315024 missense probably benign 0.08
R1815:Ltbp1 UTSW 17 75252380 missense probably benign 0.00
R1932:Ltbp1 UTSW 17 75313034 missense probably benign 0.01
R1951:Ltbp1 UTSW 17 75151377 missense probably benign 0.00
R2044:Ltbp1 UTSW 17 75276432 missense probably damaging 1.00
R2118:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2121:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2122:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2171:Ltbp1 UTSW 17 75291317 missense probably damaging 0.99
R2237:Ltbp1 UTSW 17 75310163 missense probably benign 0.31
R2655:Ltbp1 UTSW 17 75005983 missense possibly damaging 0.76
R2941:Ltbp1 UTSW 17 75179093 missense probably damaging 1.00
R3177:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3177:Ltbp1 UTSW 17 75359278 splice site probably null
R3277:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3277:Ltbp1 UTSW 17 75359278 splice site probably null
R3797:Ltbp1 UTSW 17 75362630 missense probably damaging 1.00
R3861:Ltbp1 UTSW 17 75359338 missense possibly damaging 0.93
R3897:Ltbp1 UTSW 17 75274016 missense probably damaging 1.00
R4002:Ltbp1 UTSW 17 75310159 missense probably benign 0.09
R4057:Ltbp1 UTSW 17 75310194 missense probably damaging 1.00
R4261:Ltbp1 UTSW 17 75291367 nonsense probably null
R4375:Ltbp1 UTSW 17 75312997 missense probably damaging 1.00
R4458:Ltbp1 UTSW 17 75276507 missense possibly damaging 0.96
R4519:Ltbp1 UTSW 17 75364497 missense probably benign 0.14
R4529:Ltbp1 UTSW 17 75151360 missense probably benign 0.21
R4614:Ltbp1 UTSW 17 75289994 intron probably benign
R4724:Ltbp1 UTSW 17 75313008 missense probably damaging 0.99
R4756:Ltbp1 UTSW 17 75225204 missense probably damaging 1.00
R4907:Ltbp1 UTSW 17 75005904 missense probably benign
R4910:Ltbp1 UTSW 17 75327292 missense probably damaging 1.00
R4976:Ltbp1 UTSW 17 75321095 critical splice donor site probably null
R5011:Ltbp1 UTSW 17 75066157 missense probably damaging 0.99
R5047:Ltbp1 UTSW 17 75292886 splice site probably benign
R5259:Ltbp1 UTSW 17 75363362 missense probably benign 0.03
R5438:Ltbp1 UTSW 17 75291326 missense probably damaging 0.98
R5583:Ltbp1 UTSW 17 75291330 missense probably benign 0.00
R5757:Ltbp1 UTSW 17 75273949 synonymous probably null
R5950:Ltbp1 UTSW 17 75273870 missense probably damaging 1.00
R5976:Ltbp1 UTSW 17 75290083 missense probably damaging 1.00
R6267:Ltbp1 UTSW 17 75005989 missense possibly damaging 0.70
R6383:Ltbp1 UTSW 17 75359457 missense probably damaging 0.99
R6400:Ltbp1 UTSW 17 75151402 missense possibly damaging 0.62
R6861:Ltbp1 UTSW 17 75227192 missense possibly damaging 0.76
R6880:Ltbp1 UTSW 17 75321049 missense possibly damaging 0.77
X0001:Ltbp1 UTSW 17 75227178 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCAGCCATAGTGAATGAGGCC -3'
(R):5'- CAAGTTTACCTGCAGTAAGGAGC -3'

Sequencing Primer
(F):5'- CATAGTGAATGAGGCCCCCGAAG -3'
(R):5'- ACCACTCAGTTCTGCTCATGAAGG -3'
Posted On2014-09-18