Incidental Mutation 'R2121:Olfr1045'
ID231429
Institutional Source Beutler Lab
Gene Symbol Olfr1045
Ensembl Gene ENSMUSG00000075198
Gene Nameolfactory receptor 1045
SynonymsMOR185-2, GA_x6K02T2Q125-47672825-47671878
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2121 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86195910-86203009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86197996 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 252 (Y252F)
Ref Sequence ENSEMBL: ENSMUSP00000148982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099904] [ENSMUST00000215763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099904
AA Change: Y252F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097488
Gene: ENSMUSG00000075198
AA Change: Y252F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-43 PFAM
Pfam:7tm_1 41 290 5.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215763
AA Change: Y252F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216885
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Ambn T A 5: 88,460,758 probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gstm7 T C 3: 107,926,914 M175V probably benign Het
Hcn4 T C 9: 58,824,058 S183P unknown Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmed11 G A 5: 108,795,332 probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Olfr1045
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr1045 APN 2 86197805 makesense probably null
IGL01914:Olfr1045 APN 2 86198672 missense probably benign 0.45
IGL01991:Olfr1045 APN 2 86198533 missense probably benign 0.23
IGL02623:Olfr1045 APN 2 86198019 missense probably damaging 1.00
R0325:Olfr1045 UTSW 2 86198711 missense possibly damaging 0.51
R0730:Olfr1045 UTSW 2 86198725 missense probably benign 0.14
R1457:Olfr1045 UTSW 2 86198252 missense probably damaging 0.99
R2037:Olfr1045 UTSW 2 86197832 missense probably benign
R2271:Olfr1045 UTSW 2 86197817 missense probably benign 0.00
R3836:Olfr1045 UTSW 2 86198662 missense probably benign 0.02
R4669:Olfr1045 UTSW 2 86197933 missense possibly damaging 0.90
R6082:Olfr1045 UTSW 2 86198317 missense probably damaging 0.97
R7326:Olfr1045 UTSW 2 86198573 missense probably damaging 1.00
R7463:Olfr1045 UTSW 2 86197838 missense probably benign
R7523:Olfr1045 UTSW 2 86198045 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACATGGACTTGTCATGAATCTC -3'
(R):5'- GCACAGCCATTGTCGTTTCATC -3'

Sequencing Primer
(F):5'- GTCATGAATCTCTTTAAAGCGGCC -3'
(R):5'- TGACACCTACCTTCCAGAAACTGTAG -3'
Posted On2014-09-18