Incidental Mutation 'R2121:Ambn'
ID231443
Institutional Source Beutler Lab
Gene Symbol Ambn
Ensembl Gene ENSMUSG00000029288
Gene Nameameloblastin
Synonyms
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R2121 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88455991-88468531 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 88460758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031226] [ENSMUST00000198265]
Predicted Effect probably benign
Transcript: ENSMUST00000031226
SMART Domains Protein: ENSMUSP00000031226
Gene: ENSMUSG00000029288

DomainStartEndE-ValueType
Amelin 11 407 7.19e-250 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198265
SMART Domains Protein: ENSMUSP00000142944
Gene: ENSMUSG00000029288

DomainStartEndE-ValueType
Amelin 11 422 8.22e-268 SMART
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes an extracellular matrix glycoprotein that is involved in the formation of dental enamel. Mice lacking the encoded protein fail to undergo normal ameloblast differentiation and develop enamel. Mice overproducing the product of this gene develop thinner and more porous enamel, with disrupted rod patterns and abnormal crystallites. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice lack enamel and display abnormal ameloblast and tooth morphology and an increased incidence of dental epithelium derived tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gstm7 T C 3: 107,926,914 M175V probably benign Het
Hcn4 T C 9: 58,824,058 S183P unknown Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1045 T A 2: 86,197,996 Y252F possibly damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmed11 G A 5: 108,795,332 probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Ambn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ambn APN 5 88459359 missense probably damaging 0.99
IGL01139:Ambn APN 5 88464517 splice site probably benign
IGL01318:Ambn APN 5 88460695 splice site probably benign
IGL02139:Ambn APN 5 88465290 missense probably benign
IGL02261:Ambn APN 5 88456948 missense probably damaging 1.00
IGL02743:Ambn APN 5 88464484 missense probably damaging 0.99
IGL03329:Ambn APN 5 88461668 missense probably benign 0.34
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0563:Ambn UTSW 5 88463450 missense probably benign 0.28
R1649:Ambn UTSW 5 88464481 missense probably benign 0.16
R2118:Ambn UTSW 5 88460758 splice site probably benign
R2124:Ambn UTSW 5 88460758 splice site probably benign
R2495:Ambn UTSW 5 88467804 missense probably benign 0.05
R2877:Ambn UTSW 5 88460700 splice site probably benign
R3779:Ambn UTSW 5 88465342 splice site probably benign
R4760:Ambn UTSW 5 88467707 missense probably damaging 1.00
R5422:Ambn UTSW 5 88464511 critical splice donor site probably null
R5755:Ambn UTSW 5 88464491 synonymous probably null
R5883:Ambn UTSW 5 88467829 nonsense probably null
R5970:Ambn UTSW 5 88467951 missense possibly damaging 0.88
R6846:Ambn UTSW 5 88461715 missense possibly damaging 0.65
R7166:Ambn UTSW 5 88467528 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCAGACTGAACATGGCAAAGC -3'
(R):5'- TGCATTCTCTGTGCATCAGC -3'

Sequencing Primer
(F):5'- CTGAACATGGCAAAGCTACATTTTAC -3'
(R):5'- ATTAACTGTGTAGCCCAGGC -3'
Posted On2014-09-18