Incidental Mutation 'R2121:Tmed11'
ID231444
Institutional Source Beutler Lab
Gene Symbol Tmed11
Ensembl Gene ENSMUSG00000004821
Gene Nametransmembrane p24 trafficking protein 11
Synonyms1810008K16Rik
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R2121 (G1)
Quality Score162
Status Validated
Chromosome5
Chromosomal Location108777235-108795363 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 108795332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004943] [ENSMUST00000172140]
Predicted Effect probably benign
Transcript: ENSMUST00000004943
SMART Domains Protein: ENSMUSP00000004943
Gene: ENSMUSG00000004821

DomainStartEndE-ValueType
EMP24_GP25L 17 210 1.11e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172140
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Ambn T A 5: 88,460,758 probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gstm7 T C 3: 107,926,914 M175V probably benign Het
Hcn4 T C 9: 58,824,058 S183P unknown Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1045 T A 2: 86,197,996 Y252F possibly damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Tmed11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tmed11 APN 5 108786165 missense probably benign 0.00
IGL01612:Tmed11 APN 5 108779884 missense possibly damaging 0.82
R0109:Tmed11 UTSW 5 108777412 missense probably damaging 1.00
R0109:Tmed11 UTSW 5 108777412 missense probably damaging 1.00
R0725:Tmed11 UTSW 5 108778989 missense probably damaging 1.00
R0836:Tmed11 UTSW 5 108795309 start codon destroyed probably null 0.47
R1195:Tmed11 UTSW 5 108779019 missense possibly damaging 0.73
R1195:Tmed11 UTSW 5 108779019 missense possibly damaging 0.73
R1195:Tmed11 UTSW 5 108779019 missense possibly damaging 0.73
R1551:Tmed11 UTSW 5 108779814 critical splice donor site probably null
R1815:Tmed11 UTSW 5 108777425 missense probably benign
R2004:Tmed11 UTSW 5 108786134 missense possibly damaging 0.48
R3116:Tmed11 UTSW 5 108779839 missense probably damaging 0.96
R4896:Tmed11 UTSW 5 108795182 splice site probably null
R5070:Tmed11 UTSW 5 108795223 missense probably benign 0.01
R5104:Tmed11 UTSW 5 108777276 utr 3 prime probably null
R5678:Tmed11 UTSW 5 108786165 missense probably benign 0.00
R6967:Tmed11 UTSW 5 108778914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAATAATGCAGACCTCTG -3'
(R):5'- GGAAATACCCCAAAATCTAAGTGG -3'

Sequencing Primer
(F):5'- GCAGACCTCTGGAGATTAATTAGC -3'
(R):5'- CCCAAAATCTAAGTGGTTTCTTTTTG -3'
Posted On2014-09-18