Incidental Mutation 'R2121:Hcn4'
ID231458
Institutional Source Beutler Lab
Gene Symbol Hcn4
Ensembl Gene ENSMUSG00000032338
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 4
Synonyms
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2121 (G1)
Quality Score161
Status Not validated
Chromosome9
Chromosomal Location58823412-58863175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58824058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 183 (S183P)
Ref Sequence ENSEMBL: ENSMUSP00000034889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034889]
Predicted Effect unknown
Transcript: ENSMUST00000034889
AA Change: S183P
SMART Domains Protein: ENSMUSP00000034889
Gene: ENSMUSG00000032338
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 97 120 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
Pfam:Ion_trans_N 218 261 1.2e-23 PFAM
Pfam:Ion_trans 262 525 2.2e-25 PFAM
low complexity region 526 537 N/A INTRINSIC
Blast:cNMP 538 570 9e-13 BLAST
cNMP 595 708 2.27e-23 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 808 818 N/A INTRINSIC
low complexity region 831 856 N/A INTRINSIC
low complexity region 866 906 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 931 956 N/A INTRINSIC
low complexity region 960 987 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
low complexity region 1021 1036 N/A INTRINSIC
low complexity region 1045 1073 N/A INTRINSIC
low complexity region 1123 1140 N/A INTRINSIC
low complexity region 1154 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience embryonic lethality between E9.5 and E11.5. Conditional deletion in cardiac tissue results in severe bradycardia and death. Mice over-expressing the gene exhibit impaired firing rate in ORN, small olfactory bulb and reduced glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Ambn T A 5: 88,460,758 probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gstm7 T C 3: 107,926,914 M175V probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1045 T A 2: 86,197,996 Y252F possibly damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmed11 G A 5: 108,795,332 probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Hcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hcn4 APN 9 58860053 missense unknown
IGL00939:Hcn4 APN 9 58843927 missense probably benign 0.39
IGL01154:Hcn4 APN 9 58859079 missense unknown
IGL01408:Hcn4 APN 9 58859886 missense unknown
IGL02658:Hcn4 APN 9 58859465 missense unknown
IGL02877:Hcn4 APN 9 58859167 missense unknown
IGL03211:Hcn4 APN 9 58858151 missense unknown
PIT1430001:Hcn4 UTSW 9 58859550 missense unknown
R0049:Hcn4 UTSW 9 58860299 missense probably damaging 0.98
R0268:Hcn4 UTSW 9 58860162 missense unknown
R0812:Hcn4 UTSW 9 58823512 start codon destroyed probably null
R3035:Hcn4 UTSW 9 58823680 missense unknown
R3715:Hcn4 UTSW 9 58844036 missense unknown
R3737:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R3958:Hcn4 UTSW 9 58844048 missense unknown
R4035:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R4393:Hcn4 UTSW 9 58844300 missense unknown
R4418:Hcn4 UTSW 9 58843895 missense probably benign 0.39
R4532:Hcn4 UTSW 9 58857798 missense unknown
R4765:Hcn4 UTSW 9 58857977 missense unknown
R4857:Hcn4 UTSW 9 58859570 missense unknown
R4967:Hcn4 UTSW 9 58859828 missense unknown
R5068:Hcn4 UTSW 9 58860021 missense unknown
R5253:Hcn4 UTSW 9 58824275 missense unknown
R5304:Hcn4 UTSW 9 58843932 missense probably benign 0.39
R5600:Hcn4 UTSW 9 58859293 splice site probably null
R6346:Hcn4 UTSW 9 58859044 missense unknown
R6575:Hcn4 UTSW 9 58824152 missense unknown
R6622:Hcn4 UTSW 9 58857727 missense unknown
R6967:Hcn4 UTSW 9 58823945 missense unknown
R7038:Hcn4 UTSW 9 58823584 missense unknown
R7054:Hcn4 UTSW 9 58855717 missense unknown
R7229:Hcn4 UTSW 9 58853399 missense unknown
R7407:Hcn4 UTSW 9 58859370 missense unknown
R7448:Hcn4 UTSW 9 58844299 missense unknown
R7531:Hcn4 UTSW 9 58860137 missense unknown
X0009:Hcn4 UTSW 9 58860759 nonsense probably null
X0057:Hcn4 UTSW 9 58859368 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGGCGTGGATCATGGACG -3'
(R):5'- TTTCTGGCTGCCGAACATCC -3'

Sequencing Primer
(F):5'- ACCAACGGTGACTGCAG -3'
(R):5'- CATCCTTAGGGAGAATTTGTTGACCC -3'
Posted On2014-09-18