Incidental Mutation 'R2121:Heatr1'
ID231467
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 040125-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R2121 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12403264 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 359 (V359A)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046]
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: V359A

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: V359A

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000221046
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Adnp2 A G 18: 80,129,170 F675L probably benign Het
Akna G A 4: 63,376,900 T1024I probably benign Het
Ambn T A 5: 88,460,758 probably benign Het
Aox3 T C 1: 58,152,549 probably benign Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef26 A T 3: 62,340,283 N263Y probably damaging Het
Arpp21 A G 9: 112,136,670 S375P probably damaging Het
Bscl2 G T 19: 8,839,782 E25* probably null Het
Ccl12 T A 11: 82,101,950 S17R probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Ceacam9 T A 7: 16,722,003 F12I probably benign Het
Cldn23 A G 8: 35,826,235 V33A probably benign Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Col20a1 G C 2: 180,996,456 A346P probably damaging Het
Col6a3 T C 1: 90,810,365 D537G probably damaging Het
Ctnnd2 G A 15: 30,669,514 R423H probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Diaph1 A T 18: 37,896,389 M330K unknown Het
Dnah5 C T 15: 28,297,005 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancl G T 11: 26,459,841 probably benign Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gstm7 T C 3: 107,926,914 M175V probably benign Het
Hcn4 T C 9: 58,824,058 S183P unknown Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Kdm3b T C 18: 34,796,780 probably benign Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Lyst A G 13: 13,660,971 Y1746C probably damaging Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mlc1 A G 15: 88,963,431 Y305H probably benign Het
Muc4 A G 16: 32,760,238 Y2474C unknown Het
Mybphl A C 3: 108,375,176 N175T probably damaging Het
Ncbp3 T C 11: 73,053,478 V102A possibly damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1045 T A 2: 86,197,996 Y252F possibly damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Palb2 T C 7: 122,127,781 T289A possibly damaging Het
Pde10a A T 17: 8,977,215 Q657L probably damaging Het
Ppp2r2a A T 14: 67,023,128 F234I probably damaging Het
Prl3c1 T A 13: 27,199,342 probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Serpina3m A G 12: 104,389,682 M203V possibly damaging Het
Slc6a21 A T 7: 45,288,462 I726F probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tfdp2 T C 9: 96,295,014 S75P probably damaging Het
Thegl A T 5: 77,060,758 I378L probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmed11 G A 5: 108,795,332 probably benign Het
Tmem81 C A 1: 132,508,109 Q218K probably benign Het
Tnfsf11 G A 14: 78,299,893 T110I probably benign Het
Ttc25 T A 11: 100,567,011 probably null Het
Tub G A 7: 109,026,737 G232S probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vwa5b1 T C 4: 138,588,569 T621A probably benign Het
Ythdf3 T C 3: 16,205,192 F501S possibly damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGGCCAGTAAAGTACGTATTGTTG -3'
(R):5'- GTCAGTGAACCTGCTCCCAAAC -3'

Sequencing Primer
(F):5'- GAGGCCAGTAAAGTACGTATTATTG -3'
(R):5'- CCCAAAGATTCTTTCACTCATTAGAC -3'
Posted On2014-09-18