Incidental Mutation 'R2087:Fndc3b'
ID231504
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
MMRRC Submission 040092-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2087 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27451554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 855 (V855A)
Ref Sequence ENSEMBL: ENSMUSP00000141620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000195008]
Predicted Effect probably benign
Transcript: ENSMUST00000046157
AA Change: V855A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: V855A

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195008
AA Change: V855A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: V855A

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,065,000 noncoding transcript Het
Adamts8 G A 9: 30,962,112 R871Q probably damaging Het
Ank1 T C 8: 23,093,811 L310S probably damaging Het
Atp2a3 A G 11: 72,980,448 T592A probably damaging Het
Bpifb6 A G 2: 153,906,078 D219G possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccdc14 T C 16: 34,695,645 probably null Het
Ces1c A C 8: 93,107,602 N353K probably benign Het
Chrna6 T A 8: 27,407,127 M241L probably benign Het
Chtf8 T A 8: 106,885,936 R124* probably null Het
Cpt1b A G 15: 89,422,208 V296A probably benign Het
Cryl1 G A 14: 57,275,945 S273L possibly damaging Het
Ctps T C 4: 120,562,815 D134G probably benign Het
Cyp4f18 T C 8: 72,000,988 M138V probably benign Het
Dnajb12 A G 10: 59,890,845 K107R possibly damaging Het
Epha1 C T 6: 42,363,568 D590N probably benign Het
Ganc A G 2: 120,457,257 Y822C probably damaging Het
Hook2 A G 8: 85,002,691 D622G probably damaging Het
Kcnj8 T A 6: 142,565,696 N395I probably benign Het
Kdm4b T C 17: 56,389,564 S427P possibly damaging Het
Krt12 A G 11: 99,418,633 F267S probably damaging Het
Lrrn2 T G 1: 132,937,751 F185V probably damaging Het
Mecom A G 3: 29,952,814 S764P probably benign Het
Mfsd14b C G 13: 65,067,982 G386R probably damaging Het
Mrm2 A G 5: 140,328,400 S227P probably damaging Het
Mug1 A G 6: 121,856,291 N285S probably benign Het
Nalcn T C 14: 123,281,145 T1661A probably benign Het
Ncoa6 G A 2: 155,406,159 R1742* probably null Het
Nln T A 13: 104,037,369 H548L probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr457 A T 6: 42,472,051 N42K probably damaging Het
Olfr688 T A 7: 105,288,186 I31N probably benign Het
Pgm5 T C 19: 24,733,563 Y425C probably damaging Het
Pld2 A G 11: 70,542,960 D242G probably damaging Het
Plekhm1 A G 11: 103,397,025 probably null Het
Ptdss1 T C 13: 66,976,817 probably benign Het
Pyroxd2 G T 19: 42,733,770 L415I probably benign Het
Rapgef6 A G 11: 54,631,249 T291A probably damaging Het
Rb1 A G 14: 73,280,252 I238T probably benign Het
Rp1 G A 1: 4,348,352 H846Y probably damaging Het
Rpgrip1 T A 14: 52,136,622 probably null Het
Scaf4 T C 16: 90,252,425 D258G unknown Het
Ska1 A T 18: 74,206,849 C9S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc43a1 G A 2: 84,849,831 R107Q probably damaging Het
Slc44a3 T A 3: 121,525,670 N141Y probably damaging Het
Slit1 A T 19: 41,637,483 D613E probably benign Het
Spata22 A T 11: 73,340,253 Y111F probably benign Het
Tchh C A 3: 93,443,918 R222S unknown Het
Tekt3 A G 11: 63,094,697 D443G possibly damaging Het
Tns2 A T 15: 102,107,119 Q144L possibly damaging Het
Troap T C 15: 99,078,817 V274A possibly damaging Het
Ugt1a8 A G 1: 88,088,273 Y136C probably damaging Het
Vmn2r23 A T 6: 123,741,499 M604L probably benign Het
Vps13b T A 15: 35,597,493 W1060R probably damaging Het
Wdfy3 A G 5: 101,895,060 S1942P probably damaging Het
Wdr90 G A 17: 25,846,603 T1596I probably damaging Het
Zc3h4 A G 7: 16,416,940 E69G possibly damaging Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0101:Fndc3b UTSW 3 27458808 missense probably damaging 1.00
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4628:Fndc3b UTSW 3 27556128 missense probably benign 0.19
R4747:Fndc3b UTSW 3 27428965 missense probably damaging 0.98
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5392:Fndc3b UTSW 3 27465787 nonsense probably null
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
R7038:Fndc3b UTSW 3 27501469 missense probably benign 0.23
R7102:Fndc3b UTSW 3 27470234 missense possibly damaging 0.73
R7203:Fndc3b UTSW 3 27456485 missense probably benign 0.00
R7472:Fndc3b UTSW 3 27461744 missense not run
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCTGTCTCCCAGATCGATG -3'
(R):5'- CATATGCCACTCTGGACCTC -3'

Sequencing Primer
(F):5'- GCTGTCTCCCAGATCGATGTTATAAG -3'
(R):5'- AGGATGACCTCTGACCTTCACATG -3'
Posted On2014-09-18