Incidental Mutation 'R2090:Zfp652'
ID231727
Institutional Source Beutler Lab
Gene Symbol Zfp652
Ensembl Gene ENSMUSG00000075595
Gene Namezinc finger protein 652
Synonyms9530033F24Rik
MMRRC Submission 040095-MU
Accession Numbers

Ncbi RefSeq: NM_201609.2; MGI:2442221

Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location95712673-95835115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95754008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000115393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091565] [ENSMUST00000107717] [ENSMUST00000133070] [ENSMUST00000148945]
Predicted Effect probably benign
Transcript: ENSMUST00000091565
AA Change: D420G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089153
Gene: ENSMUSG00000075595
AA Change: D420G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107717
AA Change: D420G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103345
Gene: ENSMUSG00000075595
AA Change: D420G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133070
AA Change: D420G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595
AA Change: D420G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148945
AA Change: D240G

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115393
Gene: ENSMUSG00000075595
AA Change: D240G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
ZnF_C2H2 118 141 4.34e-1 SMART
ZnF_C2H2 148 170 2.53e-2 SMART
ZnF_C2H2 176 198 6.78e-3 SMART
ZnF_C2H2 204 226 2.95e-3 SMART
ZnF_C2H2 232 254 1.95e-3 SMART
ZnF_C2H2 260 282 1.15e-5 SMART
ZnF_C2H2 288 308 6.15e1 SMART
low complexity region 328 349 N/A INTRINSIC
low complexity region 364 396 N/A INTRINSIC
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
Allele List at MGI

All alleles(23) : Targeted(1) Gene trapped(22)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Zfp652
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0432:Zfp652 UTSW 11 95763739 missense possibly damaging 0.50
R0464:Zfp652 UTSW 11 95763649 missense probably damaging 0.99
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1920:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R1922:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R2290:Zfp652 UTSW 11 95750023 missense possibly damaging 0.58
R2656:Zfp652 UTSW 11 95749329 missense probably damaging 0.98
R4790:Zfp652 UTSW 11 95749609 missense probably damaging 0.99
R5073:Zfp652 UTSW 11 95750064 missense possibly damaging 0.65
R5098:Zfp652 UTSW 11 95752936 missense probably damaging 1.00
R5209:Zfp652 UTSW 11 95763665 missense possibly damaging 0.66
R5569:Zfp652 UTSW 11 95749290 missense probably benign
R5905:Zfp652 UTSW 11 95749863 missense probably benign
R6026:Zfp652 UTSW 11 95749962 missense possibly damaging 0.95
R6054:Zfp652 UTSW 11 95749863 missense probably benign
R6629:Zfp652 UTSW 11 95763790 missense probably damaging 0.96
R6815:Zfp652 UTSW 11 95749404 nonsense probably null
R6932:Zfp652 UTSW 11 95763841 missense probably benign
R7384:Zfp652 UTSW 11 95753004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGTAAGCTGCTGAGG -3'
(R):5'- GCCTACAGAGATACCATGTCTC -3'

Sequencing Primer
(F):5'- AAGCTGCTGAGGGTGGGC -3'
(R):5'- TGCAAATGTGTGCCAGTCAC -3'
Posted On2014-09-18