Incidental Mutation 'R2090:Gsdmc2'
ID231735
Institutional Source Beutler Lab
Gene Symbol Gsdmc2
Ensembl Gene ENSMUSG00000056293
Gene Namegasdermin C2
Synonyms
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location63824346-63845177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63826826 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 307 (Y307F)
Ref Sequence ENSEMBL: ENSMUSP00000140487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089900] [ENSMUST00000188404] [ENSMUST00000188691]
Predicted Effect probably benign
Transcript: ENSMUST00000089900
AA Change: Y307F

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087344
Gene: ENSMUSG00000056293
AA Change: Y307F

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.8e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188404
AA Change: Y307F

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141066
Gene: ENSMUSG00000056293
AA Change: Y307F

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188691
AA Change: Y307F

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140487
Gene: ENSMUSG00000056293
AA Change: Y307F

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.7e-148 PFAM
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Gsdmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Gsdmc2 APN 15 63828271 splice site probably benign
IGL02212:Gsdmc2 APN 15 63828062 splice site probably benign
IGL02394:Gsdmc2 APN 15 63835880 missense probably damaging 1.00
IGL02683:Gsdmc2 APN 15 63833412 missense probably damaging 1.00
R0046:Gsdmc2 UTSW 15 63827755 splice site probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0105:Gsdmc2 UTSW 15 63828177 missense probably benign
R0655:Gsdmc2 UTSW 15 63827773 missense probably benign 0.00
R1066:Gsdmc2 UTSW 15 63825050 missense possibly damaging 0.92
R1283:Gsdmc2 UTSW 15 63825057 missense probably damaging 0.99
R1691:Gsdmc2 UTSW 15 63833465 missense probably damaging 1.00
R1727:Gsdmc2 UTSW 15 63849779 unclassified probably benign
R1911:Gsdmc2 UTSW 15 63827772 missense probably benign 0.00
R1990:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R1991:Gsdmc2 UTSW 15 63828237 missense probably benign 0.00
R2018:Gsdmc2 UTSW 15 63828126 intron probably null
R3037:Gsdmc2 UTSW 15 63833331 missense probably benign 0.00
R3964:Gsdmc2 UTSW 15 63849834 unclassified probably benign
R4308:Gsdmc2 UTSW 15 63848705 unclassified probably benign
R4574:Gsdmc2 UTSW 15 63828023 critical splice donor site probably null
R4738:Gsdmc2 UTSW 15 63826801 nonsense probably null
R4873:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4875:Gsdmc2 UTSW 15 63828252 missense probably benign 0.41
R4883:Gsdmc2 UTSW 15 63835765 missense probably damaging 1.00
R5115:Gsdmc2 UTSW 15 63827768 missense probably benign 0.00
R5241:Gsdmc2 UTSW 15 63824894 missense probably benign 0.00
R5510:Gsdmc2 UTSW 15 63828196 missense probably benign
R5841:Gsdmc2 UTSW 15 63826210 missense probably benign 0.00
R5987:Gsdmc2 UTSW 15 63830866 missense probably benign 0.00
R6199:Gsdmc2 UTSW 15 63825113 missense probably benign 0.01
R6359:Gsdmc2 UTSW 15 63825017 missense probably damaging 1.00
R6610:Gsdmc2 UTSW 15 63825008 missense probably benign 0.03
R6984:Gsdmc2 UTSW 15 63825049 nonsense probably null
R7092:Gsdmc2 UTSW 15 63825098 missense probably damaging 0.99
R7204:Gsdmc2 UTSW 15 63825054 missense probably damaging 1.00
R7247:Gsdmc2 UTSW 15 63833334 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTGAAATCCCCACCTTTGAC -3'
(R):5'- CTCAAGCAAGCTGTCAATTGAGAC -3'

Sequencing Primer
(F):5'- GACATCTTTCTCAGTGTCGTCAG -3'
(R):5'- TAGGTGCTGGAAAATGATACCATCCC -3'
Posted On2014-09-18