Incidental Mutation 'R2093:Map2'
ID231888
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R2093 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66399440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000123647] [ENSMUST00000145419] [ENSMUST00000173855]
Predicted Effect probably damaging
Transcript: ENSMUST00000024639
AA Change: V105A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077355
AA Change: V105A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114012
AA Change: V105A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: V105A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114015
AA Change: V105A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114017
AA Change: V105A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114018
AA Change: V105A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123647
AA Change: V105A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119341
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 3.8e-5 PFAM
low complexity region 120 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128673
Predicted Effect probably damaging
Transcript: ENSMUST00000141148
AA Change: V41A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222
AA Change: V41A

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect possibly damaging
Transcript: ENSMUST00000173855
AA Change: V105A

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174590
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Brip1 T C 11: 86,139,145 T558A possibly damaging Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Drc3 C T 11: 60,370,484 R154W probably damaging Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Gm3604 G T 13: 62,369,606 H313N possibly damaging Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr1076 A C 2: 86,509,243 Q261H probably damaging Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rpgrip1l T C 8: 91,270,132 S105G possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACCCTAGAAGAAAAGTTCTC -3'
(R):5'- CAGGCCTGTCTGCTTCTAGTAG -3'

Sequencing Primer
(F):5'- GACCCTAGAAGAAAAGTTCTCAATTG -3'
(R):5'- CTGCTTCTAGTAGAGGTGACAG -3'
Posted On2014-09-18