Incidental Mutation 'R2093:Olfr1076'
ID231893
Institutional Source Beutler Lab
Gene Symbol Olfr1076
Ensembl Gene ENSMUSG00000060742
Gene Nameolfactory receptor 1076
SynonymsGA_x6K02T2Q125-47993761-47994702, MOR189-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2093 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86508461-86509402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86509243 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 261 (Q261H)
Ref Sequence ENSEMBL: ENSMUSP00000075612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076263]
Predicted Effect probably damaging
Transcript: ENSMUST00000076263
AA Change: Q261H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075612
Gene: ENSMUSG00000060742
AA Change: Q261H

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.6e-52 PFAM
Pfam:7tm_1 41 290 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217442
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Brip1 T C 11: 86,139,145 T558A possibly damaging Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Drc3 C T 11: 60,370,484 R154W probably damaging Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Gm3604 G T 13: 62,369,606 H313N possibly damaging Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Map2 T C 1: 66,399,440 V41A probably damaging Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rpgrip1l T C 8: 91,270,132 S105G possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Olfr1076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Olfr1076 APN 2 86509169 missense possibly damaging 0.91
IGL03157:Olfr1076 APN 2 86509023 missense possibly damaging 0.95
ANU05:Olfr1076 UTSW 2 86509169 missense possibly damaging 0.91
IGL02802:Olfr1076 UTSW 2 86508946 missense probably benign
R0325:Olfr1076 UTSW 2 86509205 missense probably benign 0.14
R0384:Olfr1076 UTSW 2 86509383 missense possibly damaging 0.80
R1164:Olfr1076 UTSW 2 86508684 missense probably damaging 1.00
R1618:Olfr1076 UTSW 2 86508849 missense probably damaging 1.00
R1915:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R1999:Olfr1076 UTSW 2 86508745 nonsense probably null
R3824:Olfr1076 UTSW 2 86509023 missense possibly damaging 0.95
R4259:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R4928:Olfr1076 UTSW 2 86509125 missense probably damaging 1.00
R4981:Olfr1076 UTSW 2 86508827 missense probably damaging 1.00
R4998:Olfr1076 UTSW 2 86509355 missense probably benign 0.00
R5783:Olfr1076 UTSW 2 86508638 missense probably damaging 1.00
R6384:Olfr1076 UTSW 2 86509037 missense probably benign
R6549:Olfr1076 UTSW 2 86509382 missense probably benign 0.00
R6893:Olfr1076 UTSW 2 86508792 missense probably damaging 1.00
R7145:Olfr1076 UTSW 2 86508528 missense probably damaging 1.00
R7157:Olfr1076 UTSW 2 86509025 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGTGATGGTCTCCCCTTGATATC -3'
(R):5'- CCTTAAATAACGTGTGTTCTAGGAG -3'

Sequencing Primer
(F):5'- CTCTGCTCTGCTCAAATAAAAAGG -3'
(R):5'- CGTGTGTTCTAGGAGAAGATATTTTG -3'
Posted On2014-09-18