Incidental Mutation 'R2093:Rpgrip1l'
ID231916
Institutional Source Beutler Lab
Gene Symbol Rpgrip1l
Ensembl Gene ENSMUSG00000033282
Gene NameRpgrip1-like
SynonymsNphp8, fantom, Ftm, 1700047E16Rik
Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2093 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location91217030-91313262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91270132 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 105 (S105G)
Ref Sequence ENSEMBL: ENSMUSP00000147300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113] [ENSMUST00000209616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047783
AA Change: S707G

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: S707G

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
coiled coil region 196 268 N/A INTRINSIC
coiled coil region 299 371 N/A INTRINSIC
coiled coil region 395 454 N/A INTRINSIC
coiled coil region 520 556 N/A INTRINSIC
Pfam:C2-C2_1 597 738 5.8e-61 PFAM
low complexity region 769 778 N/A INTRINSIC
C2 791 896 1.06e-5 SMART
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1057 1080 N/A INTRINSIC
Blast:C2 1098 1223 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136198
Predicted Effect probably benign
Transcript: ENSMUST00000139113
SMART Domains Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209616
AA Change: S105G

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Brip1 T C 11: 86,139,145 T558A possibly damaging Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Drc3 C T 11: 60,370,484 R154W probably damaging Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Gm3604 G T 13: 62,369,606 H313N possibly damaging Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Map2 T C 1: 66,399,440 V41A probably damaging Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr1076 A C 2: 86,509,243 Q261H probably damaging Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Rpgrip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rpgrip1l APN 8 91263574 missense possibly damaging 0.52
IGL00932:Rpgrip1l APN 8 91275637 missense probably benign 0.33
IGL01113:Rpgrip1l APN 8 91260739 intron probably benign
IGL01151:Rpgrip1l APN 8 91275149 missense probably damaging 1.00
IGL01321:Rpgrip1l APN 8 91260873 nonsense probably null
IGL01384:Rpgrip1l APN 8 91273640 missense probably benign 0.00
IGL01634:Rpgrip1l APN 8 91252543 missense probably benign
IGL01634:Rpgrip1l APN 8 91252544 missense probably benign 0.25
IGL01781:Rpgrip1l APN 8 91270218 missense probably benign 0.16
IGL01784:Rpgrip1l APN 8 91270461 missense possibly damaging 0.56
IGL02034:Rpgrip1l APN 8 91251148 critical splice donor site probably null
IGL02250:Rpgrip1l APN 8 91232861 missense probably benign 0.00
IGL02285:Rpgrip1l APN 8 91232907 missense possibly damaging 0.92
IGL02634:Rpgrip1l APN 8 91225344 splice site probably benign
IGL02736:Rpgrip1l APN 8 91263591 missense possibly damaging 0.91
IGL02825:Rpgrip1l APN 8 91304805 missense probably damaging 0.99
IGL02962:Rpgrip1l APN 8 91270362 missense possibly damaging 0.95
IGL03031:Rpgrip1l APN 8 91260783 missense probably damaging 1.00
IGL03184:Rpgrip1l APN 8 91300809 missense probably damaging 1.00
P0005:Rpgrip1l UTSW 8 91299225 splice site probably benign
R0118:Rpgrip1l UTSW 8 91270122 missense probably damaging 1.00
R0490:Rpgrip1l UTSW 8 91299845 splice site probably benign
R0599:Rpgrip1l UTSW 8 91305000 missense probably damaging 1.00
R1514:Rpgrip1l UTSW 8 91260750 missense probably damaging 1.00
R1648:Rpgrip1l UTSW 8 91252889 missense probably damaging 1.00
R1914:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R1915:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R2225:Rpgrip1l UTSW 8 91221467 missense probably benign 0.45
R2504:Rpgrip1l UTSW 8 91280716 critical splice donor site probably null
R3859:Rpgrip1l UTSW 8 91263658 missense probably benign 0.00
R4118:Rpgrip1l UTSW 8 91252907 missense probably benign
R4801:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4802:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4921:Rpgrip1l UTSW 8 91261009 missense probably benign 0.05
R4976:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5092:Rpgrip1l UTSW 8 91221384 nonsense probably null
R5099:Rpgrip1l UTSW 8 91248722 missense probably benign 0.20
R5119:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5141:Rpgrip1l UTSW 8 91260918 missense probably benign 0.29
R5793:Rpgrip1l UTSW 8 91260772 missense probably benign 0.06
R5847:Rpgrip1l UTSW 8 91304985 missense probably damaging 1.00
R5871:Rpgrip1l UTSW 8 91221386 missense possibly damaging 0.89
R5916:Rpgrip1l UTSW 8 91252913 missense possibly damaging 0.93
R6619:Rpgrip1l UTSW 8 91232871 missense possibly damaging 0.69
R6654:Rpgrip1l UTSW 8 91220205 missense probably benign 0.36
R6984:Rpgrip1l UTSW 8 91260798 missense probably benign 0.03
Z1088:Rpgrip1l UTSW 8 91220179 makesense probably null
Z1088:Rpgrip1l UTSW 8 91260975 missense possibly damaging 0.96
Z1088:Rpgrip1l UTSW 8 91270120 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTATTTGCACCATCATTCATGACAC -3'
(R):5'- GCAGACTACTCCCATAGTGC -3'

Sequencing Primer
(F):5'- CACTAAAGAGAGTTCAGTCACTTGTG -3'
(R):5'- CGAGGCCTTTACCCGGAGTATAAC -3'
Posted On2014-09-18