Incidental Mutation 'R2095:Cntnap5a'
ID232012
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116442260 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 869 (L869Q)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably damaging
Transcript: ENSMUST00000043725
AA Change: L869Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: L869Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cluh C T 11: 74,661,724 R532* probably null Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TAGTGGAGTTCAGAAATGCCC -3'
(R):5'- CAAAGCAATCTTGTAGGTACTTAGC -3'

Sequencing Primer
(F):5'- CAGAAATGCCCTCTGTATGTTGACAG -3'
(R):5'- TCCCTCATACTCTGTGGA -3'
Posted On2014-09-18