Incidental Mutation 'R2095:Cluh'
ID232063
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Synonyms1300001I01Rik
MMRRC Submission 040099-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R2095 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 74661724 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 532 (R532*)
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
Predicted Effect probably null
Transcript: ENSMUST00000092915
AA Change: R532*
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: R532*

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117818
AA Change: R532*
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: R532*

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik C A 4: 122,702,358 Y127* probably null Het
Adam33 C T 2: 131,053,709 G562D probably damaging Het
Adh1 T C 3: 138,282,796 F177L probably damaging Het
Arhgef17 T C 7: 100,881,263 T1439A probably damaging Het
Arl5c C T 11: 97,993,451 E105K probably damaging Het
Armc3 T A 2: 19,288,929 D510E possibly damaging Het
Bbx T C 16: 50,224,689 E395G possibly damaging Het
Cacna2d2 G A 9: 107,527,165 E1087K probably benign Het
Casq1 T C 1: 172,215,962 N113S probably benign Het
Cbfa2t3 A G 8: 122,634,988 S432P probably benign Het
Cd163 A G 6: 124,317,822 D615G probably damaging Het
Chrnb2 A T 3: 89,761,437 D190E probably benign Het
Clec9a T C 6: 129,416,358 L115P possibly damaging Het
Cntnap5a T A 1: 116,442,260 L869Q probably damaging Het
Ctgf T C 10: 24,596,479 V140A probably benign Het
Cyp3a57 A T 5: 145,369,134 K143* probably null Het
Dcaf12 G T 4: 41,294,085 H351N probably benign Het
Dtna T A 18: 23,569,748 L112Q probably damaging Het
Fnta G A 8: 25,999,879 Q303* probably null Het
Frs2 T C 10: 117,074,602 E285G probably benign Het
Gabra4 T C 5: 71,624,112 I293V probably damaging Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Gnl2 C T 4: 125,034,318 R49C probably damaging Het
Helz T A 11: 107,646,146 Y275N probably damaging Het
Hydin A G 8: 110,462,657 E1231G probably damaging Het
Kctd11 T A 11: 69,879,576 D212V probably damaging Het
Klf3 T A 5: 64,821,902 M29K probably benign Het
Klhl21 T C 4: 152,009,393 S151P probably benign Het
Lsm14b A T 2: 180,031,787 probably benign Het
Mlxipl T C 5: 135,122,120 probably benign Het
Mov10 G A 3: 104,801,531 R389C probably damaging Het
Msh6 A G 17: 87,988,233 M1071V possibly damaging Het
Myh8 G T 11: 67,286,224 A401S probably benign Het
Ndufv3 T C 17: 31,527,486 S117P possibly damaging Het
Obscn A T 11: 59,093,584 probably null Het
Olfr1205 T C 2: 88,831,290 Y58H probably damaging Het
Olfr150 T A 9: 39,737,261 Y149N probably damaging Het
Olfr166 T C 16: 19,486,931 I31T probably benign Het
Olfr381 T A 11: 73,486,594 T77S probably damaging Het
Pcdhb17 T A 18: 37,486,322 D388E probably benign Het
Pgm3 T C 9: 86,556,341 T423A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
S1pr5 T A 9: 21,244,858 T91S probably benign Het
Sgcz T C 8: 37,540,392 probably benign Het
Slc33a1 A G 3: 63,963,955 L79P probably damaging Het
Slco2a1 A G 9: 103,076,968 T383A probably benign Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Spta1 T A 1: 174,244,198 M2248K possibly damaging Het
Stub1 A G 17: 25,830,890 Y304H probably damaging Het
Taar7e T A 10: 24,038,051 Y146* probably null Het
Tbc1d1 C T 5: 64,316,501 S660L probably benign Het
Tcea2 C A 2: 181,686,932 F259L probably damaging Het
Tcp11l1 T A 2: 104,681,840 K482N probably damaging Het
Trpv6 C T 6: 41,621,756 R645Q probably damaging Het
Uaca T A 9: 60,840,843 S30T probably benign Het
Ubap2 C G 4: 41,206,901 V492L possibly damaging Het
Ube3c T C 5: 29,668,040 F1026S probably damaging Het
Vmn2r8 T G 5: 108,808,621 D45A possibly damaging Het
Zfp738 G T 13: 67,671,303 L180I probably damaging Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 unclassified probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AACAACATCTTCTTCAGCCTGGG -3'
(R):5'- TGATGCCCTTACACTCGACC -3'

Sequencing Primer
(F):5'- TTTGATGTCCGGGACCACTACAAAG -3'
(R):5'- TTACACTCGACCGAGGAGCAG -3'
Posted On2014-09-18