Incidental Mutation 'R2107:Fam208a'
ID232196
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 040111-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2107 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 27461787 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably null
Transcript: ENSMUST00000022450
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223688
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,795,732 L364Q probably damaging Het
9030624J02Rik T C 7: 118,794,539 probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Acp2 G A 2: 91,203,595 probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Cblb T A 16: 52,152,716 probably null Het
Ccdc88c G T 12: 100,921,549 D1557E probably benign Het
Cdc20 T C 4: 118,433,513 Y430C probably damaging Het
Cdk5rap1 C T 2: 154,353,246 D350N probably benign Het
Cgrrf1 T A 14: 46,853,376 probably benign Het
Chia1 T A 3: 106,128,840 Y185* probably null Het
Cmtm8 A T 9: 114,796,108 V85D possibly damaging Het
Cplx4 A G 18: 65,956,893 S152P probably benign Het
Crmp1 G T 5: 37,242,494 R117L probably benign Het
Csad G C 15: 102,179,034 L365V probably null Het
Dyrk1a C T 16: 94,686,527 T532M probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fan1 T G 7: 64,366,788 R529S probably damaging Het
Fbln5 A G 12: 101,771,269 W173R probably damaging Het
Gm9611 A T 14: 42,294,654 N42K possibly damaging Het
Gnal T A 18: 67,213,578 L257Q probably damaging Het
Hint3 A T 10: 30,618,256 F33I probably damaging Het
Ipcef1 A G 10: 6,890,501 S403P probably benign Het
Kmt2c T C 5: 25,309,824 N3007S probably benign Het
Kpna3 T C 14: 61,370,484 D424G possibly damaging Het
Krt90 A G 15: 101,562,629 I66T probably benign Het
Lamc2 A G 1: 153,154,386 probably benign Het
Lmtk3 G T 7: 45,793,969 C692F possibly damaging Het
Lrguk T C 6: 34,062,361 M269T probably benign Het
Lrrc19 T A 4: 94,639,294 T227S probably benign Het
Lrrk1 C A 7: 66,279,282 D1201Y probably damaging Het
Matn2 T A 15: 34,423,759 Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 W346R probably damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nedd9 A T 13: 41,338,979 C12* probably null Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nisch C T 14: 31,172,140 V172I probably damaging Het
Npy2r A T 3: 82,541,129 probably null Het
Ogg1 C A 6: 113,329,293 N150K probably damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr59 T C 11: 74,289,390 V248A probably damaging Het
Olfr818 A G 10: 129,945,712 S2P probably damaging Het
Pck1 G C 2: 173,154,068 E120Q probably benign Het
Pde11a A G 2: 76,337,922 V229A probably damaging Het
Pias2 T C 18: 77,097,471 F83L probably benign Het
Plagl1 A C 10: 13,128,647 probably benign Het
Plin3 A T 17: 56,284,391 S130T probably benign Het
Rcc2 A G 4: 140,721,185 Y515C probably damaging Het
Rgs12 A G 5: 34,966,735 K621E possibly damaging Het
Rnf6 G A 5: 146,211,281 T309I probably damaging Het
Rpusd3 G T 6: 113,415,562 T335N probably damaging Het
Scn8a A T 15: 101,018,363 I1218F probably damaging Het
Slc23a1 T A 18: 35,625,826 Q104L possibly damaging Het
Slc34a3 A T 2: 25,230,987 V363D probably damaging Het
Smap1 A T 1: 23,848,454 M248K possibly damaging Het
Sp1 A G 15: 102,409,678 probably null Het
Tbc1d1 T G 5: 64,284,705 N689K probably benign Het
Tff2 T C 17: 31,142,282 E99G possibly damaging Het
Tjp3 T C 10: 81,280,544 N239D possibly damaging Het
Trim37 G A 11: 87,159,825 R230Q probably benign Het
Ubr5 A G 15: 37,989,302 M2090T probably benign Het
Unc13a T C 8: 71,656,251 probably null Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vav2 T C 2: 27,267,303 E829G probably damaging Het
Zfp26 A T 9: 20,442,237 D85E probably benign Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGCAGAAGTCGTCTCATTCTTTG -3'
(R):5'- TCCAGTGTGAAACCCTGCAG -3'

Sequencing Primer
(F):5'- AAGTCGTCTCATTCTTTGGATTATG -3'
(R):5'- CCCGGACAATTCTGGTTT -3'
Posted On2014-09-18