Incidental Mutation 'R0193:Cic'
ID23223
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission 038452-MU
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R0193 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25287140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1299 (S1299T)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]
Predicted Effect probably damaging
Transcript: ENSMUST00000005578
AA Change: S392T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S392T

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163320
AA Change: S392T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S392T

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably benign
Transcript: ENSMUST00000164820
SMART Domains Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165239
AA Change: S392T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S392T

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: S1299T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1299T

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170500
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,422,359 Q352L probably damaging Het
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Bscl2 T A 19: 8,847,429 M292K probably benign Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 E145K probably benign Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Limch1 T C 5: 67,027,539 W791R probably damaging Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngef A G 1: 87,509,334 L144P probably benign Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Nup153 G A 13: 46,709,654 T349I probably benign Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense not run
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTTCAAGAACTGACCCAGGTTCG -3'
(R):5'- GAAGCCGTACACTAGGAAGAGCATC -3'

Sequencing Primer
(F):5'- TTCGAGTCTCAGGTCACCAG -3'
(R):5'- TCCGTGGCTGAAGTATATCCAAC -3'
Posted On2013-04-16