Incidental Mutation 'R2108:Kirrel1'
ID 232233
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
MMRRC Submission 040112-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2108 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86996458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,552,303 (GRCm39) M190T probably benign Het
Abhd5 A G 9: 122,207,005 (GRCm39) Y250C probably damaging Het
Ace2 A G X: 162,923,728 (GRCm39) N24S probably benign Het
Adamtsl2 A G 2: 26,985,570 (GRCm39) M485V probably benign Het
Adamtsl4 G T 3: 95,588,357 (GRCm39) P577H probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Apc T C 18: 34,402,282 (GRCm39) Y141H probably damaging Het
Arsi A T 18: 61,049,443 (GRCm39) T109S possibly damaging Het
Asb3 G A 11: 31,031,355 (GRCm39) probably null Het
Atm T C 9: 53,355,297 (GRCm39) D2899G probably damaging Het
Bcas3 G A 11: 85,348,704 (GRCm39) V199I probably damaging Het
Bub1 T C 2: 127,661,255 (GRCm39) K279E probably damaging Het
C3 A T 17: 57,530,974 (GRCm39) probably null Het
Cabcoco1 T C 10: 68,267,153 (GRCm39) K185E probably benign Het
Cadm2 A T 16: 66,528,357 (GRCm39) I326N probably benign Het
Ccr3 T C 9: 123,829,336 (GRCm39) S224P possibly damaging Het
Cdhr4 A G 9: 107,874,843 (GRCm39) T638A probably damaging Het
Cfap46 T C 7: 139,263,677 (GRCm39) I4V probably benign Het
Csf2rb2 A T 15: 78,176,744 (GRCm39) V216E probably damaging Het
Csmd3 A T 15: 47,868,257 (GRCm39) D754E possibly damaging Het
Dnaaf1 T C 8: 120,309,471 (GRCm39) probably null Het
Dnah11 A C 12: 117,984,088 (GRCm39) Y2466D probably damaging Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
E2f7 T C 10: 110,616,763 (GRCm39) Y668H probably benign Het
Ehmt1 A T 2: 24,727,630 (GRCm39) S735T probably damaging Het
Eomes T C 9: 118,307,920 (GRCm39) F65L probably benign Het
Ercc6l2 T C 13: 64,019,802 (GRCm39) probably benign Het
Fbrsl1 A T 5: 110,526,300 (GRCm39) L439Q probably damaging Het
Fyco1 C T 9: 123,626,581 (GRCm39) probably null Het
Gfm2 A G 13: 97,291,950 (GRCm39) T229A probably benign Het
Gm7735 G A 16: 88,966,433 (GRCm39) G19D unknown Het
Gnpda1 T C 18: 38,466,243 (GRCm39) probably null Het
Gpr6 T A 10: 40,946,649 (GRCm39) Y311F possibly damaging Het
Gprc6a A T 10: 51,491,304 (GRCm39) V744E probably damaging Het
Grin3a C T 4: 49,665,510 (GRCm39) D1042N possibly damaging Het
Gstm3 A G 3: 107,873,450 (GRCm39) C174R probably damaging Het
Hectd4 A G 5: 121,471,487 (GRCm39) E2670G possibly damaging Het
Hsd3b6 A T 3: 98,713,503 (GRCm39) Y265* probably null Het
Hus1 T A 11: 8,961,110 (GRCm39) M1L probably null Het
Idi2l G A 13: 8,991,764 (GRCm39) P221S possibly damaging Het
Ifi213 T G 1: 173,396,668 (GRCm39) probably null Het
Igf2r A C 17: 12,917,138 (GRCm39) N1587K probably benign Het
Ints1 A T 5: 139,753,505 (GRCm39) V709E probably damaging Het
Ints8 C A 4: 11,235,552 (GRCm39) R359L probably damaging Het
Lrp1b C T 2: 41,000,769 (GRCm39) E2152K probably damaging Het
Lrp2 A T 2: 69,336,968 (GRCm39) V1268D possibly damaging Het
Mpo T C 11: 87,686,901 (GRCm39) Y177H probably damaging Het
Mpp4 G A 1: 59,182,941 (GRCm39) P322L possibly damaging Het
Mprip A G 11: 59,660,717 (GRCm39) K2166R probably damaging Het
Myo15a T C 11: 60,382,636 (GRCm39) Y1544H probably damaging Het
Neu1 G A 17: 35,153,374 (GRCm39) R299Q probably benign Het
Nfxl1 C A 5: 72,671,675 (GRCm39) probably null Het
Nrp2 T A 1: 62,783,436 (GRCm39) I179N probably damaging Het
Nup153 A G 13: 46,846,986 (GRCm39) probably null Het
Or1j4 C A 2: 36,740,355 (GRCm39) A99E possibly damaging Het
Or2g7 G T 17: 38,378,746 (GRCm39) R228L possibly damaging Het
Or5p54 A T 7: 107,554,709 (GRCm39) H287L probably benign Het
Or6c6c A T 10: 129,541,490 (GRCm39) I248L probably benign Het
Or8g27 A T 9: 39,129,318 (GRCm39) I222F probably damaging Het
P2ry12 A T 3: 59,124,774 (GRCm39) D300E probably damaging Het
Pkhd1 C A 1: 20,623,798 (GRCm39) G766* probably null Het
Plagl1 A C 10: 13,004,391 (GRCm39) probably benign Het
Prkcq A T 2: 11,237,380 (GRCm39) Y53F probably damaging Het
Psg18 T C 7: 18,084,799 (GRCm39) E99G probably damaging Het
Ptprz1 T A 6: 23,033,476 (GRCm39) H1921Q probably damaging Het
Rcc1l A G 5: 134,184,629 (GRCm39) V391A probably benign Het
Sdr42e1 C T 8: 118,391,763 (GRCm39) V11I probably damaging Het
Slc12a3 C A 8: 95,067,158 (GRCm39) N404K probably damaging Het
Slc38a4 T C 15: 96,906,878 (GRCm39) M287V probably benign Het
Slc6a8 A T X: 72,720,492 (GRCm39) I96F possibly damaging Het
Smyd2 A G 1: 189,629,623 (GRCm39) S136P probably damaging Het
Sox11 A G 12: 27,391,702 (GRCm39) Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 (GRCm39) P198L possibly damaging Het
Tcof1 G T 18: 60,968,845 (GRCm39) A256E probably damaging Het
Tenm4 A G 7: 96,555,497 (GRCm39) Y2726C probably damaging Het
Tnfsf14 T A 17: 57,497,867 (GRCm39) R122W probably damaging Het
Tril T C 6: 53,796,068 (GRCm39) T385A probably damaging Het
Trrap A G 5: 144,762,684 (GRCm39) T2386A probably benign Het
Tspear T A 10: 77,706,253 (GRCm39) L341H possibly damaging Het
Uba7 A G 9: 107,856,487 (GRCm39) M595V probably benign Het
Usp43 GC G 11: 67,746,566 (GRCm39) probably null Het
Utrn C A 10: 12,312,108 (GRCm39) D616Y probably damaging Het
Vmn2r69 T C 7: 85,059,404 (GRCm39) I502V probably benign Het
Vps13d C A 4: 144,801,617 (GRCm39) G419C probably damaging Het
Zbtb25 A T 12: 76,396,880 (GRCm39) M114K probably benign Het
Zcchc4 A G 5: 52,953,474 (GRCm39) Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 (GRCm39) F1484I possibly damaging Het
Zfp326 A G 5: 106,062,646 (GRCm39) probably benign Het
Zfp395 T A 14: 65,630,565 (GRCm39) S372T probably benign Het
Zfp423 T A 8: 88,507,806 (GRCm39) E825V possibly damaging Het
Zfp445 A T 9: 122,681,305 (GRCm39) Y879N probably benign Het
Zfp451 A G 1: 33,818,248 (GRCm39) I77T possibly damaging Het
Zfp85 A T 13: 67,897,003 (GRCm39) S356R probably benign Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1226:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3196:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3877:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4067:Kirrel1 UTSW 3 86,995,774 (GRCm39) nonsense probably null
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4650:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7332:Kirrel1 UTSW 3 86,995,705 (GRCm39) missense probably benign 0.14
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTCC -3'
(R):5'- GAGCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On 2014-09-18