Incidental Mutation 'R2109:Megf6'
ID232352
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 040113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2109 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 154177121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 68 (V68L)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
AA Change: V68L

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: V68L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cd300lb G A 11: 114,926,039 S195F probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Ltn1 T C 16: 87,415,642 D677G probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Olfr1381 T G 11: 49,552,433 S229A probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 T A 11: 119,442,663 Y2899* probably null Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh2b1 A T 7: 126,472,364 D216E possibly damaging Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tnk1 A T 11: 69,855,183 D305E probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTGGGCAAATGAGCTATG -3'
(R):5'- CTAGAATCTGGGGTGAAAGGCC -3'

Sequencing Primer
(F):5'- TGGGCAAATGAGCTATGGTCTAG -3'
(R):5'- GGCCATGCCCTCAGTAAAG -3'
Posted On2014-09-18