Incidental Mutation 'R2109:Cd300lb'
ID232396
Institutional Source Beutler Lab
Gene Symbol Cd300lb
Ensembl Gene ENSMUSG00000063193
Gene NameCD300 molecule like family member B
SynonymsClm7, LOC217304, CLM-7, LMIR5
MMRRC Submission 040113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2109 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114922781-114934386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114926039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 195 (S195F)
Ref Sequence ENSEMBL: ENSMUSP00000102191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106581] [ENSMUST00000149663]
Predicted Effect probably damaging
Transcript: ENSMUST00000074300
AA Change: S195F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073913
Gene: ENSMUSG00000063193
AA Change: S195F

DomainStartEndE-ValueType
IG 67 168 1.17e-4 SMART
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106581
AA Change: S195F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102191
Gene: ENSMUSG00000063193
AA Change: S195F

DomainStartEndE-ValueType
IG 21 122 1.17e-4 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126655
Predicted Effect probably damaging
Transcript: ENSMUST00000149663
AA Change: S59F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144728
Gene: ENSMUSG00000063193
AA Change: S59F

DomainStartEndE-ValueType
Blast:IG 1 32 4e-16 BLAST
transmembrane domain 66 88 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD300LB is a nonclassical activating receptor of the immunoglobulin (Ig) superfamily expressed on myeloid cells (Martinez-Barriocanal and Sayos, 2006 [PubMed 16920917]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation do not display any gross abnormalities and are protected from ischemia reperfusion induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Ltn1 T C 16: 87,415,642 D677G probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Olfr1381 T G 11: 49,552,433 S229A probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 T A 11: 119,442,663 Y2899* probably null Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh2b1 A T 7: 126,472,364 D216E possibly damaging Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tnk1 A T 11: 69,855,183 D305E probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Cd300lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Cd300lb APN 11 114928477 nonsense probably null
IGL03412:Cd300lb APN 11 114928380 missense probably damaging 1.00
R0003:Cd300lb UTSW 11 114928338 missense probably benign 0.12
R0034:Cd300lb UTSW 11 114928399 missense probably damaging 0.99
R1518:Cd300lb UTSW 11 114926051 missense probably benign 0.09
R5296:Cd300lb UTSW 11 114924937 missense possibly damaging 0.73
R7325:Cd300lb UTSW 11 114925032 missense probably damaging 1.00
R7426:Cd300lb UTSW 11 114928302 missense probably damaging 0.99
R7484:Cd300lb UTSW 11 114928519 missense probably damaging 1.00
Z1088:Cd300lb UTSW 11 114926034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTCTCCAGGCTTGGC -3'
(R):5'- CCTGGTGAAGGCCGGTTG -3'

Sequencing Primer
(F):5'- GCAGAGCTGAGAGTTCTACATCTTC -3'
(R):5'- AAGGCCGGTTGGATTGGGATAC -3'
Posted On2014-09-18