Incidental Mutation 'R2109:Rnf213'
ID232399
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 040113-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2109 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 119442663 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 2899 (Y2899*)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect probably null
Transcript: ENSMUST00000093902
AA Change: Y2900*
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: Y2900*

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000131035
AA Change: Y2899*
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: Y2899*

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cd300lb G A 11: 114,926,039 S195F probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Ltn1 T C 16: 87,415,642 D677G probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Olfr1381 T G 11: 49,552,433 S229A probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh2b1 A T 7: 126,472,364 D216E possibly damaging Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tnk1 A T 11: 69,855,183 D305E probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
dinky UTSW 11 119416458 missense probably damaging 0.99
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGCATTGAAGATGACCCTGCC -3'
(R):5'- CTGTAAAGATGCTCAGGGCC -3'

Sequencing Primer
(F):5'- TTGAAGATGACCCTGCCCCATAC -3'
(R):5'- CCTGGATGTTGTCTTTACCACTGAAG -3'
Posted On2014-09-18