Incidental Mutation 'R2111:Mcf2l'
ID232552
Institutional Source Beutler Lab
Gene Symbol Mcf2l
Ensembl Gene ENSMUSG00000031442
Gene Namemcf.2 transforming sequence-like
SynonymsC130040G20Rik, Dbs
MMRRC Submission 040115-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2111 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12873806-13020905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13001867 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 433 (K433N)
Ref Sequence ENSEMBL: ENSMUSP00000106491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173006] [ENSMUST00000173099]
Predicted Effect probably damaging
Transcript: ENSMUST00000095456
AA Change: K485N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442
AA Change: K485N

DomainStartEndE-ValueType
SEC14 75 221 1.77e-24 SMART
SPEC 354 455 4.41e-15 SMART
coiled coil region 507 529 N/A INTRINSIC
low complexity region 578 594 N/A INTRINSIC
RhoGEF 636 811 2.83e-63 SMART
PH 831 948 8.13e-14 SMART
low complexity region 966 978 N/A INTRINSIC
SH3 1058 1115 3.33e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098927
AA Change: K459N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442
AA Change: K459N

DomainStartEndE-ValueType
SEC14 49 195 1.77e-24 SMART
SPEC 328 429 4.41e-15 SMART
coiled coil region 481 503 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
RhoGEF 610 785 2.83e-63 SMART
PH 805 922 8.13e-14 SMART
low complexity region 940 952 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110866
AA Change: K433N

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442
AA Change: K433N

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110867
AA Change: K433N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442
AA Change: K433N

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110871
AA Change: K453N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442
AA Change: K453N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SEC14 43 189 1.77e-24 SMART
SPEC 322 423 4.41e-15 SMART
coiled coil region 475 497 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
RhoGEF 604 779 2.83e-63 SMART
PH 799 916 8.13e-14 SMART
low complexity region 934 946 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110873
AA Change: K296N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442
AA Change: K296N

DomainStartEndE-ValueType
SPEC 165 266 4.41e-15 SMART
coiled coil region 318 340 N/A INTRINSIC
low complexity region 389 405 N/A INTRINSIC
RhoGEF 447 622 2.83e-63 SMART
PH 642 759 8.13e-14 SMART
low complexity region 777 789 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110876
AA Change: K455N

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442
AA Change: K455N

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1084 1141 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110879
AA Change: K455N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442
AA Change: K455N

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1028 1085 3.33e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126905
AA Change: K117N
SMART Domains Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442
AA Change: K117N

DomainStartEndE-ValueType
SPEC 5 88 8.25e-6 SMART
coiled coil region 139 161 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
RhoGEF 269 444 2.83e-63 SMART
PH 464 581 8.13e-14 SMART
low complexity region 599 611 N/A INTRINSIC
SH3 716 773 3.33e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145067
AA Change: K392N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442
AA Change: K392N

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 16 132 2.4e-12 PFAM
SPEC 261 362 4.41e-15 SMART
coiled coil region 414 436 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
RhoGEF 543 718 2.83e-63 SMART
PH 738 855 8.13e-14 SMART
low complexity region 873 885 N/A INTRINSIC
SH3 1021 1078 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173006
AA Change: K364N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134147
Gene: ENSMUSG00000031442
AA Change: K364N

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 1 104 1.3e-12 PFAM
SPEC 233 334 4.41e-15 SMART
coiled coil region 386 408 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
RhoGEF 515 690 2.83e-63 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173099
AA Change: K451N

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442
AA Change: K451N

DomainStartEndE-ValueType
SEC14 41 187 1.77e-24 SMART
SPEC 320 421 4.41e-15 SMART
coiled coil region 473 495 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
RhoGEF 602 777 2.83e-63 SMART
PH 797 914 8.13e-14 SMART
low complexity region 932 944 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Adam9 C T 8: 24,982,126 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Akp3 A T 1: 87,126,885 probably null Het
Alpk2 T C 18: 65,349,774 S388G probably benign Het
Amph G A 13: 19,116,266 probably benign Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp2a2 A G 5: 122,459,546 F808S probably damaging Het
Baz1a T A 12: 54,911,385 N1027I probably damaging Het
C2cd4c G T 10: 79,612,421 H297Q probably damaging Het
Calr3 T A 8: 72,427,268 D160V probably damaging Het
Cdc42ep1 C T 15: 78,847,492 R46C probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Cyp2e1 C A 7: 140,773,634 T328K probably damaging Het
Dcp1a T C 14: 30,519,370 V379A probably benign Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ercc6l2 A G 13: 63,834,749 T126A probably damaging Het
Fgf6 T C 6: 127,015,760 S59P probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gapvd1 G T 2: 34,684,317 A1256D probably benign Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Gk2 T C 5: 97,456,305 I225V probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm4788 T A 1: 139,774,679 probably benign Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Ift172 G A 5: 31,286,079 T112M probably benign Het
Igkv1-115 C A 6: 68,161,629 S72* probably null Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Itpr1 T G 6: 108,378,309 probably benign Het
Khdrbs3 C T 15: 69,024,824 T111I probably benign Het
Mageb3 A G 2: 121,954,825 probably null Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Mtr A T 13: 12,244,601 I196N possibly damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T A 8: 61,124,326 probably null Het
Nes A G 3: 87,977,311 E915G probably benign Het
Nlrp4f T C 13: 65,199,353 I30M probably benign Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Nup155 A G 15: 8,121,467 I334V probably benign Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1469 G A 19: 13,410,943 A125T probably damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr418 A T 1: 173,270,312 M46L probably benign Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Pja2 T A 17: 64,290,036 D553V probably damaging Het
Prune2 T C 19: 17,208,238 F3004L probably damaging Het
Rasgrp3 T C 17: 75,500,758 probably null Het
Rdh13 A G 7: 4,445,483 V10A probably benign Het
Rimbp2 T C 5: 128,773,501 Y906C probably damaging Het
Ripor1 T C 8: 105,614,712 F59S probably damaging Het
Rnf185 T C 11: 3,432,393 probably benign Het
Runx3 T C 4: 135,155,316 V107A probably damaging Het
Scn3b T C 9: 40,282,445 V156A probably benign Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc12a7 C T 13: 73,785,155 R111* probably null Het
Slc5a5 A T 8: 70,889,751 probably null Het
Snx13 A T 12: 35,138,085 L787F probably damaging Het
Spef2 A T 15: 9,589,573 M1535K probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tagln3 A G 16: 45,711,594 Y192H probably damaging Het
Tbc1d15 A C 10: 115,240,914 S22A possibly damaging Het
Tbc1d31 A G 15: 57,932,644 E211G probably benign Het
Tmod3 A G 9: 75,509,363 V229A probably damaging Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Xrn1 C A 9: 96,039,832 H1433N probably benign Het
Zfp353-ps T A 8: 42,082,968 noncoding transcript Het
Zfp74 G A 7: 29,935,018 Q422* probably null Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Mcf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Mcf2l APN 8 13000857 missense probably damaging 0.98
IGL00426:Mcf2l APN 8 12984910 missense probably damaging 1.00
IGL01391:Mcf2l APN 8 13014010 splice site probably null
IGL01795:Mcf2l APN 8 13000749 unclassified probably null
IGL02314:Mcf2l APN 8 13001851 missense probably damaging 0.99
IGL02716:Mcf2l APN 8 12997277 missense probably benign 0.19
IGL02985:Mcf2l APN 8 12963239 missense probably damaging 1.00
IGL03073:Mcf2l APN 8 13000004 missense probably damaging 1.00
IGL03308:Mcf2l APN 8 13009512 missense probably damaging 1.00
IGL03371:Mcf2l APN 8 13001298 missense probably damaging 1.00
P0022:Mcf2l UTSW 8 13018897 nonsense probably null
R0062:Mcf2l UTSW 8 13006766 unclassified probably benign
R0067:Mcf2l UTSW 8 13013060 missense probably benign 0.01
R0110:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0450:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0469:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0510:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0543:Mcf2l UTSW 8 12996728 critical splice donor site probably null
R0591:Mcf2l UTSW 8 13018751 missense probably benign 0.11
R0801:Mcf2l UTSW 8 13014020 intron probably benign
R0962:Mcf2l UTSW 8 13001964 missense probably benign 0.14
R1084:Mcf2l UTSW 8 13002645 missense possibly damaging 0.94
R1794:Mcf2l UTSW 8 12915982 missense probably benign 0.33
R2112:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R3785:Mcf2l UTSW 8 12880099 missense probably damaging 0.97
R4777:Mcf2l UTSW 8 13018051 splice site probably null
R4858:Mcf2l UTSW 8 13013972 missense probably damaging 1.00
R4980:Mcf2l UTSW 8 12984883 missense probably damaging 1.00
R5021:Mcf2l UTSW 8 13011808 missense probably damaging 1.00
R5067:Mcf2l UTSW 8 12915959 intron probably benign
R5158:Mcf2l UTSW 8 13009715 missense probably damaging 1.00
R5439:Mcf2l UTSW 8 12926646 missense possibly damaging 0.85
R5569:Mcf2l UTSW 8 13005481 missense probably damaging 1.00
R5655:Mcf2l UTSW 8 13010444 missense probably damaging 0.98
R5668:Mcf2l UTSW 8 13013812 nonsense probably null
R5753:Mcf2l UTSW 8 12999993 missense probably damaging 1.00
R5808:Mcf2l UTSW 8 12993937 start codon destroyed probably null 0.92
R5946:Mcf2l UTSW 8 13013922 missense probably damaging 1.00
R6168:Mcf2l UTSW 8 13001823 missense probably benign 0.05
R6174:Mcf2l UTSW 8 13013849 nonsense probably null
R6212:Mcf2l UTSW 8 13017431 missense probably damaging 1.00
R6270:Mcf2l UTSW 8 13018701 missense probably damaging 0.99
R6383:Mcf2l UTSW 8 12879912 start gained probably benign
R6850:Mcf2l UTSW 8 13009476 missense possibly damaging 0.82
R6908:Mcf2l UTSW 8 13018919 missense probably benign
R7101:Mcf2l UTSW 8 13013579 missense possibly damaging 0.80
R7163:Mcf2l UTSW 8 12915439 missense probably benign 0.00
R7203:Mcf2l UTSW 8 13010456 missense probably benign 0.09
R7414:Mcf2l UTSW 8 13019022 makesense probably null
R7553:Mcf2l UTSW 8 12997268 missense probably benign
R7556:Mcf2l UTSW 8 12973071 missense probably damaging 0.99
X0052:Mcf2l UTSW 8 13018713 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTTCATCTCCTGCAGGTG -3'
(R):5'- TTCCCTGAACTATCCCATGAGG -3'

Sequencing Primer
(F):5'- GCAGGTGCATCAGACAGG -3'
(R):5'- AACTATCCCATGAGGCGGGTC -3'
Posted On2014-09-18