Incidental Mutation 'R2112:Tas1r2'
ID232641
Institutional Source Beutler Lab
Gene Symbol Tas1r2
Ensembl Gene ENSMUSG00000028738
Gene Nametaste receptor, type 1, member 2
SynonymsGpr71, TR2, T1r2
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139653538-139670280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139655355 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 101 (M101I)
Ref Sequence ENSEMBL: ENSMUSP00000127737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030510] [ENSMUST00000166773] [ENSMUST00000178644]
Predicted Effect probably benign
Transcript: ENSMUST00000030510
AA Change: M101I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030510
Gene: ENSMUSG00000028738
AA Change: M101I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 459 2e-90 PFAM
Pfam:NCD3G 495 548 2.4e-17 PFAM
Pfam:7tm_3 581 818 2.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166773
AA Change: M101I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127737
Gene: ENSMUSG00000028738
AA Change: M101I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 213 5.3e-38 PFAM
Pfam:ANF_receptor 217 429 8.4e-31 PFAM
Pfam:NCD3G 466 519 7.4e-19 PFAM
Pfam:7tm_3 550 790 3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to sweet tastants. Response to umami tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Luc7l T C 17: 26,255,127 probably null Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Notch3 T A 17: 32,144,610 I1160F probably benign Het
Nox4 T C 7: 87,372,008 L476P probably damaging Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Ralgps2 A G 1: 156,832,708 Y265H probably damaging Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Tas1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Tas1r2 APN 4 139660291 missense probably benign 0.03
IGL00952:Tas1r2 APN 4 139655252 missense probably benign 0.00
IGL00972:Tas1r2 APN 4 139660036 missense probably damaging 0.99
IGL01939:Tas1r2 APN 4 139669177 missense probably damaging 1.00
IGL02247:Tas1r2 APN 4 139669516 missense probably damaging 1.00
IGL02663:Tas1r2 APN 4 139660282 missense probably benign
IGL03155:Tas1r2 APN 4 139669156 missense possibly damaging 0.95
R0395:Tas1r2 UTSW 4 139655354 missense possibly damaging 0.86
R0798:Tas1r2 UTSW 4 139669713 missense probably damaging 1.00
R1221:Tas1r2 UTSW 4 139669125 missense probably benign 0.00
R1223:Tas1r2 UTSW 4 139660204 missense probably damaging 1.00
R1261:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1262:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1330:Tas1r2 UTSW 4 139669329 missense probably benign 0.05
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1879:Tas1r2 UTSW 4 139669695 missense probably damaging 1.00
R2156:Tas1r2 UTSW 4 139669041 missense possibly damaging 0.79
R2509:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2510:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2511:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R3429:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3430:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3703:Tas1r2 UTSW 4 139667418 missense probably damaging 1.00
R4105:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4106:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4107:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4614:Tas1r2 UTSW 4 139659787 missense probably damaging 1.00
R4811:Tas1r2 UTSW 4 139669000 missense probably damaging 1.00
R5314:Tas1r2 UTSW 4 139655361 missense probably damaging 1.00
R5461:Tas1r2 UTSW 4 139660009 missense probably benign 0.01
R5639:Tas1r2 UTSW 4 139659796 missense probably damaging 1.00
R5703:Tas1r2 UTSW 4 139667336 missense probably damaging 1.00
R6176:Tas1r2 UTSW 4 139668888 missense probably damaging 1.00
R6297:Tas1r2 UTSW 4 139662050 missense possibly damaging 0.47
R6441:Tas1r2 UTSW 4 139669156 missense probably damaging 0.99
R6748:Tas1r2 UTSW 4 139669611 missense probably damaging 0.98
R6863:Tas1r2 UTSW 4 139669719 missense probably damaging 1.00
R6975:Tas1r2 UTSW 4 139669720 missense probably damaging 1.00
R7106:Tas1r2 UTSW 4 139662049 missense probably benign
R7265:Tas1r2 UTSW 4 139669652 missense probably benign 0.01
Z1088:Tas1r2 UTSW 4 139660424 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCCAGAACTTTCTAGGGTG -3'
(R):5'- GAATGTTGGACACGGTGATG -3'

Sequencing Primer
(F):5'- TCTCTTGTGGAGAACAGAGCAGC -3'
(R):5'- ATGGCGGACTCAGAGTTGTC -3'
Posted On2014-09-18