Incidental Mutation 'R2112:Nox4'
ID232663
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87372008 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 476 (L476P)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably damaging
Transcript: ENSMUST00000032781
AA Change: L476P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: L476P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068829
AA Change: L476P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: L476P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Luc7l T C 17: 26,255,127 probably null Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Notch3 T A 17: 32,144,610 I1160F probably benign Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Ralgps2 A G 1: 156,832,708 Y265H probably damaging Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Tas1r2 G T 4: 139,655,355 M101I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGCTGAAATGGGGTCTG -3'
(R):5'- AGAAGATTCTGTCATGTCTGTGATG -3'

Sequencing Primer
(F):5'- AATTGGTTGTGTATGAATGAAAAGC -3'
(R):5'- GCAGACAGACCTGTTAAAAATGTC -3'
Posted On2014-09-18