Incidental Mutation 'R2113:Trrap'
ID232762
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 040117-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2113 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144844211 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 3261 (Y3261N)
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038980
AA Change: Y3231N

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: Y3231N

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094120
AA Change: Y3260N

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: Y3260N

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100467
AA Change: Y3231N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: Y3231N

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124909
Predicted Effect unknown
Transcript: ENSMUST00000132925
AA Change: Y2970N
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: Y2970N

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213013
AA Change: Y3261N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,772 V549A probably benign Het
Abcd4 C A 12: 84,609,016 G295* probably null Het
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Actn4 C T 7: 28,898,124 G608D probably benign Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Adh5 A G 3: 138,451,484 I269V probably benign Het
Afap1l2 G A 19: 56,913,389 A842V possibly damaging Het
AI429214 A T 8: 36,994,000 K101* probably null Het
Alg10b T A 15: 90,225,657 W58R probably damaging Het
Alpk2 C T 18: 65,305,683 E1347K probably benign Het
Amotl2 G T 9: 102,724,723 E389* probably null Het
Ap5m1 G A 14: 49,086,248 R465Q probably damaging Het
Apoa1 A C 9: 46,229,214 S48R probably damaging Het
Asb1 T C 1: 91,544,228 L34P probably damaging Het
Atg14 C T 14: 47,551,324 A191T probably damaging Het
Atp13a4 C T 16: 29,441,284 V235I possibly damaging Het
Atrnl1 C T 19: 57,755,616 Q1217* probably null Het
Bsn A T 9: 108,114,886 H1222Q probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cbx4 C T 11: 119,081,892 G219E probably damaging Het
Ccdc136 C T 6: 29,413,032 T406I possibly damaging Het
Celsr3 A T 9: 108,838,470 Y2117F probably damaging Het
Cenpf T A 1: 189,679,102 Q295L probably damaging Het
Ces1b A G 8: 93,068,155 V272A probably benign Het
Cgn A T 3: 94,779,806 V62D probably damaging Het
Ckap4 T G 10: 84,533,523 Q115P possibly damaging Het
Clec10a T C 11: 70,169,824 probably null Het
Clmn A T 12: 104,780,808 S827T probably benign Het
Cntn4 T C 6: 106,489,697 S187P probably damaging Het
Cntnap5a A T 1: 116,188,365 I526F probably damaging Het
Cntnap5b A G 1: 100,274,415 Q329R probably benign Het
Col1a1 T A 11: 94,948,362 S979T unknown Het
Crat T A 2: 30,402,642 Y606F probably benign Het
Cyp2c29 G T 19: 39,330,264 C396F probably damaging Het
Cyp2d34 G T 15: 82,617,616 P231Q probably damaging Het
Ddi2 A T 4: 141,703,280 probably null Het
Dicer1 A T 12: 104,713,214 H501Q probably damaging Het
Dnah12 A G 14: 26,766,141 I1001V probably damaging Het
Dnase2a T A 8: 84,910,871 C301S probably damaging Het
Dock10 T A 1: 80,606,563 D142V probably damaging Het
Dpp8 G A 9: 65,063,868 C590Y probably benign Het
Dst T A 1: 34,275,236 M6707K probably damaging Het
Duox1 T C 2: 122,337,254 V1006A probably benign Het
Dync1h1 T C 12: 110,629,986 S1623P probably damaging Het
Ehmt1 A T 2: 24,804,003 D1011E probably damaging Het
Epc2 T A 2: 49,532,223 D376E probably benign Het
Eps8 C A 6: 137,537,635 probably null Het
F11 T C 8: 45,246,832 T406A probably benign Het
Fat3 T G 9: 15,999,786 D1640A probably damaging Het
Fbxo15 A T 18: 84,959,105 R47S probably benign Het
Fbxo28 A T 1: 182,329,925 V109E probably damaging Het
Fn1 A T 1: 71,626,164 S931R probably damaging Het
Fndc3b T C 3: 27,643,036 D9G probably damaging Het
Frem2 G A 3: 53,652,922 T1388I probably damaging Het
Fstl3 C A 10: 79,781,178 T185N probably damaging Het
Glo1 A T 17: 30,604,040 Y49* probably null Het
Gtsf2 T C 15: 103,439,673 M137V probably benign Het
Gzmk C T 13: 113,173,955 G110S probably benign Het
Hdac9 G T 12: 34,389,332 S428R probably damaging Het
Hnrnpul1 G A 7: 25,733,269 T456I possibly damaging Het
Ino80 T A 2: 119,454,084 H172L probably damaging Het
Itgb8 A C 12: 119,190,612 L230R probably damaging Het
Klf9 C T 19: 23,164,688 R171W probably damaging Het
Kmt2b G T 7: 30,583,387 P1050Q probably damaging Het
Krt15 A T 11: 100,135,658 F67L unknown Het
Maml3 T A 3: 51,690,656 Y223F probably damaging Het
Mcm9 C T 10: 53,615,847 probably null Het
Mettl3 A G 14: 52,294,984 *104Q probably null Het
Msrb3 T A 10: 120,852,080 D30V possibly damaging Het
Mycbp2 T C 14: 103,220,076 T1562A probably damaging Het
Nat14 T C 7: 4,924,039 V70A possibly damaging Het
Nbeal2 T C 9: 110,625,406 T2685A probably damaging Het
Nek1 A G 8: 61,016,293 D128G probably damaging Het
Nfam1 T A 15: 83,015,001 K155* probably null Het
Noc4l A T 5: 110,650,559 M255K possibly damaging Het
Nolc1 CAG CAGGAG 19: 46,081,359 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,361 probably benign Het
Nprl2 T C 9: 107,545,312 S334P probably benign Het
Nsrp1 A G 11: 77,046,570 S267P probably benign Het
Ntn4 A T 10: 93,644,839 M142L probably damaging Het
Nup188 T A 2: 30,304,101 C139* probably null Het
Nup210l A T 3: 90,190,974 N1411I possibly damaging Het
Olfr1510 A G 14: 52,410,296 L192P probably damaging Het
Olfr994 T G 2: 85,430,086 T248P probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Pcnx3 G T 19: 5,671,556 D1071E possibly damaging Het
Pi4k2a T A 19: 42,115,071 I340N possibly damaging Het
Pkdrej T A 15: 85,818,984 D917V probably damaging Het
Plekhg4 T A 8: 105,379,434 F821Y probably damaging Het
Ptgfrn C T 3: 101,077,309 R189H probably benign Het
Ptpn18 T A 1: 34,471,661 S235R probably damaging Het
Rabep2 A G 7: 126,445,288 probably null Het
Rbp3 T G 14: 33,956,057 I654S probably benign Het
Rimbp3 T C 16: 17,209,675 L321P probably benign Het
Rims2 T A 15: 39,511,326 M1028K probably benign Het
Ruvbl1 T A 6: 88,483,021 V221D probably damaging Het
Ruvbl2 A T 7: 45,424,103 probably null Het
Scn7a C T 2: 66,675,968 D1526N probably damaging Het
Scnn1a T C 6: 125,337,811 F218S possibly damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Slain1 C A 14: 103,650,846 D67E possibly damaging Het
Snx33 T C 9: 56,926,440 D115G probably benign Het
Sowaha G A 11: 53,478,962 R316C probably damaging Het
Spata17 A T 1: 187,097,911 F309I possibly damaging Het
Spata48 G A 11: 11,490,293 probably null Het
Ssrp1 G T 2: 85,043,006 probably null Het
St6gal1 C G 16: 23,328,417 T225S probably damaging Het
Sulf1 C G 1: 12,848,174 F38L probably damaging Het
Tbc1d7 G A 13: 43,153,086 T138M probably damaging Het
Tdpoz4 T A 3: 93,797,044 M216K probably damaging Het
Tmem200a A G 10: 25,993,322 S350P probably damaging Het
Tnpo3 A T 6: 29,551,872 D903E probably benign Het
Trpc4ap A T 2: 155,657,936 I222N probably damaging Het
Ttn A G 2: 76,712,610 V33344A possibly damaging Het
Uchl4 A T 9: 64,235,536 T100S probably damaging Het
Uxs1 A G 1: 43,771,773 Y97H probably damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Vmn2r88 T C 14: 51,418,194 L621P probably damaging Het
Vps45 A T 3: 96,047,053 M174K probably benign Het
Wdr72 A T 9: 74,145,172 M162L probably benign Het
Wdr81 T A 11: 75,453,635 M269L probably benign Het
Zfp53 A G 17: 21,508,451 T249A probably benign Het
Zfp758 T C 17: 22,361,645 S22P probably benign Het
Zfp780b T C 7: 27,963,873 D419G possibly damaging Het
Zfp934 A T 13: 62,518,693 Y45N probably damaging Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATTCCATCTGTTGGTCAGCAAC -3'
(R):5'- AGCCTGACTACATGTGGGAG -3'

Sequencing Primer
(F):5'- TTGACCCAAGTGCACAAC -3'
(R):5'- CAGGGGTGTGCCTATCAC -3'
Posted On2014-09-18