Incidental Mutation 'R2113:Kmt2b'
ID232776
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
MMRRC Submission 040117-MU
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2113 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30583387 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1050 (P1050Q)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
Predicted Effect probably damaging
Transcript: ENSMUST00000006470
AA Change: P1050Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: P1050Q

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108154
AA Change: P1050Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: P1050Q

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125836
Predicted Effect unknown
Transcript: ENSMUST00000131002
AA Change: P341Q
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: P341Q

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,772 V549A probably benign Het
Abcd4 C A 12: 84,609,016 G295* probably null Het
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Actn4 C T 7: 28,898,124 G608D probably benign Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Adh5 A G 3: 138,451,484 I269V probably benign Het
Afap1l2 G A 19: 56,913,389 A842V possibly damaging Het
AI429214 A T 8: 36,994,000 K101* probably null Het
Alg10b T A 15: 90,225,657 W58R probably damaging Het
Alpk2 C T 18: 65,305,683 E1347K probably benign Het
Amotl2 G T 9: 102,724,723 E389* probably null Het
Ap5m1 G A 14: 49,086,248 R465Q probably damaging Het
Apoa1 A C 9: 46,229,214 S48R probably damaging Het
Asb1 T C 1: 91,544,228 L34P probably damaging Het
Atg14 C T 14: 47,551,324 A191T probably damaging Het
Atp13a4 C T 16: 29,441,284 V235I possibly damaging Het
Atrnl1 C T 19: 57,755,616 Q1217* probably null Het
Bsn A T 9: 108,114,886 H1222Q probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cbx4 C T 11: 119,081,892 G219E probably damaging Het
Ccdc136 C T 6: 29,413,032 T406I possibly damaging Het
Celsr3 A T 9: 108,838,470 Y2117F probably damaging Het
Cenpf T A 1: 189,679,102 Q295L probably damaging Het
Ces1b A G 8: 93,068,155 V272A probably benign Het
Cgn A T 3: 94,779,806 V62D probably damaging Het
Ckap4 T G 10: 84,533,523 Q115P possibly damaging Het
Clec10a T C 11: 70,169,824 probably null Het
Clmn A T 12: 104,780,808 S827T probably benign Het
Cntn4 T C 6: 106,489,697 S187P probably damaging Het
Cntnap5a A T 1: 116,188,365 I526F probably damaging Het
Cntnap5b A G 1: 100,274,415 Q329R probably benign Het
Col1a1 T A 11: 94,948,362 S979T unknown Het
Crat T A 2: 30,402,642 Y606F probably benign Het
Cyp2c29 G T 19: 39,330,264 C396F probably damaging Het
Cyp2d34 G T 15: 82,617,616 P231Q probably damaging Het
Ddi2 A T 4: 141,703,280 probably null Het
Dicer1 A T 12: 104,713,214 H501Q probably damaging Het
Dnah12 A G 14: 26,766,141 I1001V probably damaging Het
Dnase2a T A 8: 84,910,871 C301S probably damaging Het
Dock10 T A 1: 80,606,563 D142V probably damaging Het
Dpp8 G A 9: 65,063,868 C590Y probably benign Het
Dst T A 1: 34,275,236 M6707K probably damaging Het
Duox1 T C 2: 122,337,254 V1006A probably benign Het
Dync1h1 T C 12: 110,629,986 S1623P probably damaging Het
Ehmt1 A T 2: 24,804,003 D1011E probably damaging Het
Epc2 T A 2: 49,532,223 D376E probably benign Het
Eps8 C A 6: 137,537,635 probably null Het
F11 T C 8: 45,246,832 T406A probably benign Het
Fat3 T G 9: 15,999,786 D1640A probably damaging Het
Fbxo15 A T 18: 84,959,105 R47S probably benign Het
Fbxo28 A T 1: 182,329,925 V109E probably damaging Het
Fn1 A T 1: 71,626,164 S931R probably damaging Het
Fndc3b T C 3: 27,643,036 D9G probably damaging Het
Frem2 G A 3: 53,652,922 T1388I probably damaging Het
Fstl3 C A 10: 79,781,178 T185N probably damaging Het
Glo1 A T 17: 30,604,040 Y49* probably null Het
Gtsf2 T C 15: 103,439,673 M137V probably benign Het
Gzmk C T 13: 113,173,955 G110S probably benign Het
Hdac9 G T 12: 34,389,332 S428R probably damaging Het
Hnrnpul1 G A 7: 25,733,269 T456I possibly damaging Het
Ino80 T A 2: 119,454,084 H172L probably damaging Het
Itgb8 A C 12: 119,190,612 L230R probably damaging Het
Klf9 C T 19: 23,164,688 R171W probably damaging Het
Krt15 A T 11: 100,135,658 F67L unknown Het
Maml3 T A 3: 51,690,656 Y223F probably damaging Het
Mcm9 C T 10: 53,615,847 probably null Het
Mettl3 A G 14: 52,294,984 *104Q probably null Het
Msrb3 T A 10: 120,852,080 D30V possibly damaging Het
Mycbp2 T C 14: 103,220,076 T1562A probably damaging Het
Nat14 T C 7: 4,924,039 V70A possibly damaging Het
Nbeal2 T C 9: 110,625,406 T2685A probably damaging Het
Nek1 A G 8: 61,016,293 D128G probably damaging Het
Nfam1 T A 15: 83,015,001 K155* probably null Het
Noc4l A T 5: 110,650,559 M255K possibly damaging Het
Nolc1 CAG CAGGAG 19: 46,081,359 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,361 probably benign Het
Nprl2 T C 9: 107,545,312 S334P probably benign Het
Nsrp1 A G 11: 77,046,570 S267P probably benign Het
Ntn4 A T 10: 93,644,839 M142L probably damaging Het
Nup188 T A 2: 30,304,101 C139* probably null Het
Nup210l A T 3: 90,190,974 N1411I possibly damaging Het
Olfr1510 A G 14: 52,410,296 L192P probably damaging Het
Olfr994 T G 2: 85,430,086 T248P probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Pcnx3 G T 19: 5,671,556 D1071E possibly damaging Het
Pi4k2a T A 19: 42,115,071 I340N possibly damaging Het
Pkdrej T A 15: 85,818,984 D917V probably damaging Het
Plekhg4 T A 8: 105,379,434 F821Y probably damaging Het
Ptgfrn C T 3: 101,077,309 R189H probably benign Het
Ptpn18 T A 1: 34,471,661 S235R probably damaging Het
Rabep2 A G 7: 126,445,288 probably null Het
Rbp3 T G 14: 33,956,057 I654S probably benign Het
Rimbp3 T C 16: 17,209,675 L321P probably benign Het
Rims2 T A 15: 39,511,326 M1028K probably benign Het
Ruvbl1 T A 6: 88,483,021 V221D probably damaging Het
Ruvbl2 A T 7: 45,424,103 probably null Het
Scn7a C T 2: 66,675,968 D1526N probably damaging Het
Scnn1a T C 6: 125,337,811 F218S possibly damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Slain1 C A 14: 103,650,846 D67E possibly damaging Het
Snx33 T C 9: 56,926,440 D115G probably benign Het
Sowaha G A 11: 53,478,962 R316C probably damaging Het
Spata17 A T 1: 187,097,911 F309I possibly damaging Het
Spata48 G A 11: 11,490,293 probably null Het
Ssrp1 G T 2: 85,043,006 probably null Het
St6gal1 C G 16: 23,328,417 T225S probably damaging Het
Sulf1 C G 1: 12,848,174 F38L probably damaging Het
Tbc1d7 G A 13: 43,153,086 T138M probably damaging Het
Tdpoz4 T A 3: 93,797,044 M216K probably damaging Het
Tmem200a A G 10: 25,993,322 S350P probably damaging Het
Tnpo3 A T 6: 29,551,872 D903E probably benign Het
Trpc4ap A T 2: 155,657,936 I222N probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ttn A G 2: 76,712,610 V33344A possibly damaging Het
Uchl4 A T 9: 64,235,536 T100S probably damaging Het
Uxs1 A G 1: 43,771,773 Y97H probably damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Vmn2r88 T C 14: 51,418,194 L621P probably damaging Het
Vps45 A T 3: 96,047,053 M174K probably benign Het
Wdr72 A T 9: 74,145,172 M162L probably benign Het
Wdr81 T A 11: 75,453,635 M269L probably benign Het
Zfp53 A G 17: 21,508,451 T249A probably benign Het
Zfp758 T C 17: 22,361,645 S22P probably benign Het
Zfp780b T C 7: 27,963,873 D419G possibly damaging Het
Zfp934 A T 13: 62,518,693 Y45N probably damaging Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GAGCATACCATGTTCTCTGGG -3'
(R):5'- AGCTTAAACCTGTCCTGCATTG -3'

Sequencing Primer
(F):5'- TGCGACGTCTTGGAGCAG -3'
(R):5'- AAACCTGTCCTGCATTGTTTGTTTTG -3'
Posted On2014-09-18