Incidental Mutation 'R2114:Col5a2'
ID232874
Institutional Source Beutler Lab
Gene Symbol Col5a2
Ensembl Gene ENSMUSG00000026042
Gene Namecollagen, type V, alpha 2
Synonyms1110014L14Rik
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location45374321-45503282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45376804 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1394 (E1394D)
Ref Sequence ENSEMBL: ENSMUSP00000083620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086430]
Predicted Effect probably damaging
Transcript: ENSMUST00000086430
AA Change: E1394D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: E1394D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 40 95 9.94e-23 SMART
Pfam:Collagen 123 186 1.5e-10 PFAM
Pfam:Collagen 207 272 2.9e-9 PFAM
low complexity region 319 347 N/A INTRINSIC
internal_repeat_1 349 421 3.18e-18 PROSPERO
internal_repeat_2 385 422 1.34e-12 PROSPERO
internal_repeat_5 388 423 1.55e-7 PROSPERO
low complexity region 424 460 N/A INTRINSIC
low complexity region 471 508 N/A INTRINSIC
internal_repeat_6 509 535 5.68e-7 PROSPERO
internal_repeat_2 511 548 1.34e-12 PROSPERO
internal_repeat_3 520 549 1.16e-11 PROSPERO
internal_repeat_1 520 571 3.18e-18 PROSPERO
internal_repeat_4 546 574 4.91e-9 PROSPERO
low complexity region 595 611 N/A INTRINSIC
internal_repeat_7 616 741 1.35e-6 PROSPERO
low complexity region 742 757 N/A INTRINSIC
Pfam:Collagen 790 870 4.8e-8 PFAM
low complexity region 877 898 N/A INTRINSIC
Pfam:Collagen 907 979 4.2e-8 PFAM
internal_repeat_4 993 1021 4.91e-9 PROSPERO
internal_repeat_3 994 1023 1.16e-11 PROSPERO
low complexity region 1024 1054 N/A INTRINSIC
internal_repeat_6 1055 1078 5.68e-7 PROSPERO
low complexity region 1081 1096 N/A INTRINSIC
Pfam:Collagen 1111 1171 9.7e-12 PFAM
Pfam:Collagen 1168 1230 1.4e-9 PFAM
COLFI 1263 1497 1.83e-164 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Col5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Col5a2 APN 1 45392877 splice site probably benign
IGL00978:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01366:Col5a2 APN 1 45391888 missense possibly damaging 0.46
IGL01487:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01820:Col5a2 APN 1 45442825 missense unknown
IGL01980:Col5a2 APN 1 45382233 splice site probably benign
IGL02063:Col5a2 APN 1 45403419 critical splice donor site probably null
IGL02134:Col5a2 APN 1 45391070 splice site probably null
IGL02233:Col5a2 APN 1 45383587 splice site probably null
IGL02489:Col5a2 APN 1 45392811 splice site probably null
IGL02928:Col5a2 APN 1 45385020 missense probably benign 0.41
IGL02931:Col5a2 APN 1 45385065 missense probably damaging 1.00
IGL03328:Col5a2 APN 1 45376146 missense possibly damaging 0.94
R0022:Col5a2 UTSW 1 45383683 nonsense probably null
R0123:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0180:Col5a2 UTSW 1 45411460 missense probably damaging 1.00
R0225:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0455:Col5a2 UTSW 1 45382102 splice site probably benign
R0485:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R0702:Col5a2 UTSW 1 45380131 missense possibly damaging 0.54
R0745:Col5a2 UTSW 1 45407227 splice site probably null
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1394:Col5a2 UTSW 1 45403419 critical splice donor site probably null
R1494:Col5a2 UTSW 1 45502914 start codon destroyed unknown
R1499:Col5a2 UTSW 1 45411466 missense probably benign 0.00
R1733:Col5a2 UTSW 1 45407032 missense possibly damaging 0.81
R1789:Col5a2 UTSW 1 45378305 critical splice donor site probably null
R1789:Col5a2 UTSW 1 45394776 missense probably damaging 0.98
R2915:Col5a2 UTSW 1 45413496 missense probably damaging 1.00
R3861:Col5a2 UTSW 1 45380237 missense probably damaging 0.98
R4015:Col5a2 UTSW 1 45403471 missense probably benign 0.14
R4944:Col5a2 UTSW 1 45376695 missense possibly damaging 0.75
R4982:Col5a2 UTSW 1 45389458 missense possibly damaging 0.88
R5001:Col5a2 UTSW 1 45502898 missense unknown
R5159:Col5a2 UTSW 1 45386831 critical splice donor site probably null
R5197:Col5a2 UTSW 1 45393081 missense probably benign 0.01
R5407:Col5a2 UTSW 1 45406280 missense possibly damaging 0.54
R5502:Col5a2 UTSW 1 45380126 missense probably damaging 1.00
R5575:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R5622:Col5a2 UTSW 1 45427059 missense probably benign
R5643:Col5a2 UTSW 1 45390042 missense probably damaging 1.00
R5801:Col5a2 UTSW 1 45389481 critical splice acceptor site probably null
R6075:Col5a2 UTSW 1 45502848 missense unknown
R6211:Col5a2 UTSW 1 45376666 missense probably damaging 0.99
R6407:Col5a2 UTSW 1 45376778 missense probably damaging 0.99
R6494:Col5a2 UTSW 1 45378327 missense probably damaging 0.99
R6582:Col5a2 UTSW 1 45390115 missense possibly damaging 0.91
R6687:Col5a2 UTSW 1 45383604 missense probably damaging 1.00
R7007:Col5a2 UTSW 1 45378449 missense possibly damaging 0.53
R7062:Col5a2 UTSW 1 45417625 missense probably benign 0.00
R7098:Col5a2 UTSW 1 45380067 missense possibly damaging 0.48
R7243:Col5a2 UTSW 1 45376160 missense probably benign 0.39
R7326:Col5a2 UTSW 1 45442867 missense unknown
R7332:Col5a2 UTSW 1 45380165 missense probably damaging 1.00
X0013:Col5a2 UTSW 1 45403258 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCAGAAACTTTCCTTGCTGAAG -3'
(R):5'- AGTCATCTGTCGATCTACCTGG -3'

Sequencing Primer
(F):5'- CTTTCCTTGCTGAAGAAAGAGAG -3'
(R):5'- GTCGATCTACCTGGCATTGAC -3'
Posted On2014-09-18