Incidental Mutation 'R2114:Polr2b'
ID232914
Institutional Source Beutler Lab
Gene Symbol Polr2b
Ensembl Gene ENSMUSG00000029250
Gene Namepolymerase (RNA) II (DNA directed) polypeptide B
SynonymsRPB2
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.983) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77310147-77349324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77320970 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 198 (E198K)
Ref Sequence ENSEMBL: ENSMUSP00000031167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167]
Predicted Effect probably damaging
Transcript: ENSMUST00000031167
AA Change: E198K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250
AA Change: E198K

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202146
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Polr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Polr2b APN 5 77332252 missense probably benign
IGL02069:Polr2b APN 5 77343197 missense probably benign 0.01
IGL03218:Polr2b APN 5 77315917 missense probably benign 0.03
R0007:Polr2b UTSW 5 77340437 missense probably benign 0.02
R0056:Polr2b UTSW 5 77334535 missense possibly damaging 0.55
R0076:Polr2b UTSW 5 77326561 missense possibly damaging 0.78
R0099:Polr2b UTSW 5 77320950 splice site probably benign
R0114:Polr2b UTSW 5 77343263 missense probably damaging 1.00
R0193:Polr2b UTSW 5 77320076 missense probably damaging 1.00
R0481:Polr2b UTSW 5 77332082 missense possibly damaging 0.90
R0607:Polr2b UTSW 5 77313159 unclassified probably benign
R1233:Polr2b UTSW 5 77334565 missense probably benign
R1597:Polr2b UTSW 5 77326101 missense probably damaging 1.00
R1674:Polr2b UTSW 5 77326623 missense possibly damaging 0.83
R1696:Polr2b UTSW 5 77342648 missense probably benign 0.12
R1704:Polr2b UTSW 5 77342560 missense possibly damaging 0.95
R1871:Polr2b UTSW 5 77326527 splice site probably benign
R2137:Polr2b UTSW 5 77320346 missense probably benign 0.18
R2305:Polr2b UTSW 5 77320437 splice site probably benign
R3921:Polr2b UTSW 5 77326653 missense probably damaging 1.00
R4027:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4031:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4526:Polr2b UTSW 5 77326714 missense probably damaging 1.00
R4750:Polr2b UTSW 5 77332039 missense possibly damaging 0.92
R4827:Polr2b UTSW 5 77342551 missense probably benign
R5244:Polr2b UTSW 5 77343000 intron probably benign
R5360:Polr2b UTSW 5 77349146 missense possibly damaging 0.90
R5628:Polr2b UTSW 5 77313216 missense probably damaging 0.98
R5928:Polr2b UTSW 5 77345342 missense probably damaging 1.00
R6009:Polr2b UTSW 5 77320252 missense probably benign
R6179:Polr2b UTSW 5 77320977 missense probably damaging 1.00
R6251:Polr2b UTSW 5 77348294 missense probably benign 0.00
X0054:Polr2b UTSW 5 77348305 missense probably damaging 0.97
Z1088:Polr2b UTSW 5 77342722 missense possibly damaging 0.95
Z1088:Polr2b UTSW 5 77345401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTATGCATTCCTACAGATAATC -3'
(R):5'- TGTTTAAGTAGGTAAAGCAAAGCAC -3'

Sequencing Primer
(F):5'- AAGTGACAGTTGAGTTATTTAAGGTG -3'
(R):5'- GCACAAAGGAAAAGCCCAG -3'
Posted On2014-09-18