Incidental Mutation 'R2114:Lrwd1'
ID232919
Institutional Source Beutler Lab
Gene Symbol Lrwd1
Ensembl Gene ENSMUSG00000029703
Gene Nameleucine-rich repeats and WD repeat domain containing 1
Synonyms1200011O22Rik, Orca
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136122772-136136074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136130478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 431 (Y431F)
Ref Sequence ENSEMBL: ENSMUSP00000006301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000150406]
Predicted Effect probably damaging
Transcript: ENSMUST00000006301
AA Change: Y431F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703
AA Change: Y431F

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128255
SMART Domains Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
Blast:WD40 13 66 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149673
Predicted Effect probably benign
Transcript: ENSMUST00000150406
SMART Domains Protein: ENSMUSP00000121513
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
LRR_TYP 55 78 3.16e-3 SMART
LRR 99 122 1.58e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199786
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the origin recognition complex (ORC) and regulates the formation of the prereplicative complex. The encoded protein stabilizes the ORC and therefore aids in DNA replication. This protein is required for the G1/S phase transition of the cell cycle. In addition, the encoded protein binds to trimethylated histone H3 in heterochromatin and recruits the ORC and lysine methyltransferases, which help maintain the repressive heterochromatic state. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Lrwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Lrwd1 APN 5 136134629 missense probably damaging 1.00
IGL01827:Lrwd1 APN 5 136131518 nonsense probably null
IGL01919:Lrwd1 APN 5 136135875 nonsense probably null
IGL02327:Lrwd1 APN 5 136123464 missense probably damaging 1.00
R0614:Lrwd1 UTSW 5 136123500 missense probably damaging 0.99
R0882:Lrwd1 UTSW 5 136123400 splice site probably null
R1137:Lrwd1 UTSW 5 136133419 missense probably benign 0.01
R1164:Lrwd1 UTSW 5 136130990 missense probably benign 0.00
R1302:Lrwd1 UTSW 5 136132413 missense probably benign 0.05
R1838:Lrwd1 UTSW 5 136132388 missense probably benign 0.00
R2116:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2117:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R4514:Lrwd1 UTSW 5 136131548 missense probably benign 0.00
R4595:Lrwd1 UTSW 5 136123956 missense probably benign
R5304:Lrwd1 UTSW 5 136131150 missense possibly damaging 0.49
R5384:Lrwd1 UTSW 5 136123874 missense possibly damaging 0.84
R5719:Lrwd1 UTSW 5 136132239 splice site probably null
R5771:Lrwd1 UTSW 5 136123662 missense possibly damaging 0.95
R5791:Lrwd1 UTSW 5 136131033 missense probably benign 0.44
R6431:Lrwd1 UTSW 5 136133034 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCCAGCAGGAAGTCATCTG -3'
(R):5'- ATGTGCACACTAGGTTCAGG -3'

Sequencing Primer
(F):5'- AAGTCATCTGGGCAGGTGG -3'
(R):5'- CACTAGGTTCAGGCAGGACTGTG -3'
Posted On2014-09-18