Incidental Mutation 'R2114:Dnah6'
ID232924
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Namedynein, axonemal, heavy chain 6
SynonymsA730004I20Rik, Dnahc6
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location73017606-73221651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73144035 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1492 (N1492S)
Ref Sequence ENSEMBL: ENSMUSP00000144791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
Predicted Effect probably damaging
Transcript: ENSMUST00000064948
AA Change: N1492S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: N1492S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083138
Predicted Effect probably damaging
Transcript: ENSMUST00000114040
AA Change: N1440S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: N1440S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204053
AA Change: N1492S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: N1492S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 intron probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 intron probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTACCCACATGAGCTGGCC -3'
(R):5'- ATGAACCAGGCCTATGAACTTG -3'

Sequencing Primer
(F):5'- CCACAGCATGCTGACCTG -3'
(R):5'- GGCCTATGAACTTGTATTTAAAGCC -3'
Posted On2014-09-18