Incidental Mutation 'R2114:Ezh1'
ID232951
Institutional Source Beutler Lab
Gene Symbol Ezh1
Ensembl Gene ENSMUSG00000006920
Gene Nameenhancer of zeste 1 polycomb repressive complex 2 subunit
Synonyms
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101191115-101226463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101208185 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 290 (S290A)
Ref Sequence ENSEMBL: ENSMUSP00000102905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100417] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably benign
Transcript: ENSMUST00000100417
AA Change: S290A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097984
Gene: ENSMUSG00000006920
AA Change: S290A

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 1.8e-20 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
PDB:4MI0|A 521 558 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107284
AA Change: S290A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920
AA Change: S290A

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
AA Change: S293A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920
AA Change: S293A

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154211
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Polycomb-group (PcG) family. The encoded protein is interchangeable with the related Enhancer of zeste 2 (Ezh2) protein as a core component of the polycomb repressive complex 2 (PRC2), which methylates histone H3 at lysine 27 and results in the transcriptional repression of affected target genes. This complex is involved in carrying out cell-fate decisions during embryonic stem cell differentiation. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and healthy. Mice homozygous for a conditional allele activated in hematopoietic stem cells exhibit bone marrow failure with defective HSC maintenance and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Ezh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ezh1 APN 11 101194506 unclassified probably null
IGL00481:Ezh1 APN 11 101199302 missense possibly damaging 0.68
IGL01327:Ezh1 APN 11 101203436 missense probably damaging 0.97
IGL01475:Ezh1 APN 11 101192961 missense probably damaging 1.00
IGL01693:Ezh1 APN 11 101215258 missense probably benign
IGL01896:Ezh1 APN 11 101213755 missense probably benign 0.00
IGL02022:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02024:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02028:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02053:Ezh1 APN 11 101199943 splice site probably benign
IGL02101:Ezh1 APN 11 101195566 missense possibly damaging 0.50
IGL02445:Ezh1 APN 11 101210687 missense possibly damaging 0.49
IGL02882:Ezh1 APN 11 101203289 missense probably benign 0.02
IGL03303:Ezh1 APN 11 101195671 unclassified probably null
IGL03493:Ezh1 APN 11 101203791 missense probably benign 0.02
R1099:Ezh1 UTSW 11 101193808 critical splice acceptor site probably null
R1119:Ezh1 UTSW 11 101210535 splice site probably benign
R1434:Ezh1 UTSW 11 101194917 missense probably damaging 1.00
R1477:Ezh1 UTSW 11 101192984 missense probably damaging 0.98
R3105:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R3106:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R4272:Ezh1 UTSW 11 101194908 missense probably damaging 1.00
R4820:Ezh1 UTSW 11 101203768 missense probably damaging 1.00
R5016:Ezh1 UTSW 11 101199237 intron probably benign
R5237:Ezh1 UTSW 11 101216993 critical splice donor site probably null
R6392:Ezh1 UTSW 11 101203804 missense probably damaging 0.96
R6892:Ezh1 UTSW 11 101199361 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAACCACAGTGCTTAATTAGGTTG -3'
(R):5'- CCATGCTTGGATGGCAGTTC -3'

Sequencing Primer
(F):5'- AACAACTGGGCTTTCGTGAATCC -3'
(R):5'- CCCTGGCTACAGTGGAGAGTTTC -3'
Posted On2014-09-18