Incidental Mutation 'R2114:Prkcd'
ID232961
Institutional Source Beutler Lab
Gene Symbol Prkcd
Ensembl Gene ENSMUSG00000021948
Gene Nameprotein kinase C, delta
SynonymsPkcd, D14Ertd420e, PKC[d], PKCdelta
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30595354-30626210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30605851 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 208 (C208R)
Ref Sequence ENSEMBL: ENSMUSP00000107830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022521] [ENSMUST00000112202] [ENSMUST00000112203] [ENSMUST00000112206] [ENSMUST00000112207] [ENSMUST00000112210] [ENSMUST00000112211]
Predicted Effect probably damaging
Transcript: ENSMUST00000022521
AA Change: C208R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948
AA Change: C208R

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112202
AA Change: C93R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948
AA Change: C93R

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112203
AA Change: C93R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948
AA Change: C93R

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112206
AA Change: C93R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948
AA Change: C93R

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
S_TK_X 513 576 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112207
AA Change: C93R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948
AA Change: C93R

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
S_TK_X 487 550 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112208
SMART Domains Protein: ENSMUSP00000107827
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112210
AA Change: C208R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948
AA Change: C208R

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112211
AA Change: C208R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948
AA Change: C208R

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227078
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Prkcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Prkcd APN 14 30602422 splice site probably benign
IGL00715:Prkcd APN 14 30596003 missense probably damaging 1.00
IGL01914:Prkcd APN 14 30607426 missense possibly damaging 0.49
IGL02177:Prkcd APN 14 30605887 missense probably damaging 1.00
IGL02547:Prkcd APN 14 30599469 missense probably damaging 1.00
IGL02681:Prkcd APN 14 30601233 critical splice acceptor site probably null
rigged UTSW 14 30610301 start codon destroyed probably null 0.99
rigged2 UTSW 14 30599743 missense probably damaging 1.00
IGL03014:Prkcd UTSW 14 30607337 missense probably damaging 1.00
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R1385:Prkcd UTSW 14 30607405 missense probably damaging 1.00
R1567:Prkcd UTSW 14 30607448 missense probably benign 0.35
R2983:Prkcd UTSW 14 30599478 missense probably damaging 1.00
R3716:Prkcd UTSW 14 30599712 missense probably benign 0.00
R4162:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4164:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4180:Prkcd UTSW 14 30610304 utr 5 prime probably benign
R4637:Prkcd UTSW 14 30598765 missense probably benign 0.00
R4750:Prkcd UTSW 14 30610301 start codon destroyed probably null 0.99
R4756:Prkcd UTSW 14 30599666 missense probably benign 0.00
R4849:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4850:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4893:Prkcd UTSW 14 30599425 missense probably damaging 1.00
R4914:Prkcd UTSW 14 30605438 critical splice donor site probably null
R4925:Prkcd UTSW 14 30607613 missense probably damaging 0.98
R5644:Prkcd UTSW 14 30607413 missense probably benign 0.06
R5832:Prkcd UTSW 14 30605821 missense probably damaging 0.99
R5910:Prkcd UTSW 14 30595981 missense probably benign 0.01
R6049:Prkcd UTSW 14 30607297 missense possibly damaging 0.95
R6322:Prkcd UTSW 14 30599663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCAGAGGCCTAACAGGG -3'
(R):5'- TTTTCAGGCTGCTCTGGAAAG -3'

Sequencing Primer
(F):5'- TAACAGGGCTCCACCAAGGTC -3'
(R):5'- TGCTCTGGAAAGGCTAGCG -3'
Posted On2014-09-18