Incidental Mutation 'R2115:Myo3a'
ID232990
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission 040119-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2115 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22245531 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 70 (I70F)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: I70F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: I70F

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142435
Predicted Effect probably damaging
Transcript: ENSMUST00000153002
AA Change: I62F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: I62F

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Herc2 T C 7: 56,185,828 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kat7 C T 11: 95,303,294 R60Q probably benign Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Parp14 T C 16: 35,858,534 T355A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Rnf213 A G 11: 119,428,013 N1099S probably benign Het
Ros1 T C 10: 52,128,555 I969V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAGACTGAGATGCATTGAATTAG -3'
(R):5'- ACAGGTTTTGCATGCTGAAG -3'

Sequencing Primer
(F):5'- CAGAATGCAGTCGCAACA -3'
(R):5'- CAGGTTTTGCATGCTGAAGATATGAC -3'
Posted On2014-09-18