Incidental Mutation 'R0194:Sptbn4'
ID23301
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R0194 (G1)
Quality Score177
Status Validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27404911 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 962 (R962C)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]
Predicted Effect probably benign
Transcript: ENSMUST00000011895
AA Change: R967C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: R967C

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172269
AA Change: R962C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: R962C

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Spire2 G A 8: 123,363,011 probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTATCCAAATCGCGCAGGAAACG -3'
(R):5'- TGCTCTAAGCACTGTCCAGAGTGAG -3'

Sequencing Primer
(F):5'- TCTAGCGCCTGTAGAGCC -3'
(R):5'- CACTGTCCAGAGTGAGATACTATTG -3'
Posted On2013-04-16