Incidental Mutation 'R2115:Rnf213'
ID233055
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 040119-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2115 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119428013 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1099 (N1099S)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: N1100S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: N1100S

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: N1099S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: N1099S

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Herc2 T C 7: 56,185,828 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kat7 C T 11: 95,303,294 R60Q probably benign Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Myo3a A T 2: 22,245,531 I70F probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Parp14 T C 16: 35,858,534 T355A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Ros1 T C 10: 52,128,555 I969V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
dinky UTSW 11 119416458 missense probably damaging 0.99
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1789:Rnf213 UTSW 11 119440221 missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTCTGGGCTCTGTAACTGCC -3'
(R):5'- AGTCTTCAGTGCCACTCCTG -3'

Sequencing Primer
(F):5'- CAGAGAGCCTGGGAGCTTAGTTATTG -3'
(R):5'- TCCTGGGGCCCACCTTG -3'
Posted On2014-09-18