Incidental Mutation 'R2115:Parp14'
ID233076
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission 040119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R2115 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35858534 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 355 (T355A)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: T355A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: T355A

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142946
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Herc2 T C 7: 56,185,828 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kat7 C T 11: 95,303,294 R60Q probably benign Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Myo3a A T 2: 22,245,531 I70F probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Rnf213 A G 11: 119,428,013 N1099S probably benign Het
Ros1 T C 10: 52,128,555 I969V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
PIT4585001:Parp14 UTSW 16 35858605 missense probably benign 0.03
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
R7525:Parp14 UTSW 16 35857491 missense not run
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGATGTCCCATACTGGCG -3'
(R):5'- TTAGACACCGTCATGGCCAAG -3'

Sequencing Primer
(F):5'- TACTGGCGAGCACACTTC -3'
(R):5'- GTTACAACAAGATGCCACTGTCTGTC -3'
Posted On2014-09-18