Incidental Mutation 'R2116:Ciz1'
ID233106
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene NameCDKN1A interacting zinc finger protein 1
Synonyms0610038H21Rik, 2900056O04Rik
MMRRC Submission 040120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32352327-32380970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32367465 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 174 (L174P)
Ref Sequence ENSEMBL: ENSMUSP00000116812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079]
Predicted Effect probably damaging
Transcript: ENSMUST00000048964
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113331
AA Change: L150P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: L150P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113332
AA Change: L174P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113334
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113338
AA Change: L174P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125482
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132028
AA Change: L174P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect probably damaging
Transcript: ENSMUST00000136079
AA Change: L174P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205
AA Change: L174P

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect unknown
Transcript: ENSMUST00000139637
AA Change: L18P
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205
AA Change: L18P

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147338
Predicted Effect probably benign
Transcript: ENSMUST00000151806
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32372388 missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32378109 utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32371419 splice site probably benign
R0122:Ciz1 UTSW 2 32371419 splice site probably benign
R0363:Ciz1 UTSW 2 32377363 critical splice donor site probably null
R0373:Ciz1 UTSW 2 32367467 missense probably damaging 1.00
R0653:Ciz1 UTSW 2 32372406 missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32376376 unclassified probably benign
R1255:Ciz1 UTSW 2 32365876 critical splice donor site probably null
R3161:Ciz1 UTSW 2 32370063 missense probably benign 0.11
R3732:Ciz1 UTSW 2 32367483 missense possibly damaging 0.68
R4014:Ciz1 UTSW 2 32374344 missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32370099 missense possibly damaging 0.92
R4687:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R4786:Ciz1 UTSW 2 32377527 missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32371741 missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32364235 missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32372288 splice site probably benign
R5270:Ciz1 UTSW 2 32374499 unclassified probably null
R5429:Ciz1 UTSW 2 32376043 missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32371741 missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32376040 missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32367396 missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32371216 missense possibly damaging 0.85
R6187:Ciz1 UTSW 2 32370051 missense possibly damaging 0.90
R6612:Ciz1 UTSW 2 32377311 missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32371115 critical splice donor site probably null
X0018:Ciz1 UTSW 2 32371252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCCTGATATAACCTTGACCATTC -3'
(R):5'- ACAGAGCATGACTGAAGGCC -3'

Sequencing Primer
(F):5'- GACCATTCAATCATGTTATGACCTC -3'
(R):5'- CCAAAGGCCAGGGCAAGC -3'
Posted On2014-09-18