Incidental Mutation 'R2116:Tgfb1i1'
ID233156
Institutional Source Beutler Lab
Gene Symbol Tgfb1i1
Ensembl Gene ENSMUSG00000030782
Gene Nametransforming growth factor beta 1 induced transcript 1
SynonymsARA55, TSC-5, hic-5
MMRRC Submission 040120-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128246812-128255699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128252805 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 353 (R353H)
Ref Sequence ENSEMBL: ENSMUSP00000130964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070656] [ENSMUST00000163609] [ENSMUST00000164710] [ENSMUST00000165667] [ENSMUST00000167965] [ENSMUST00000169919] [ENSMUST00000170115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070656
AA Change: R314H

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068529
Gene: ENSMUSG00000030782
AA Change: R314H

DomainStartEndE-ValueType
Pfam:Paxillin 19 183 1.7e-7 PFAM
LIM 210 261 5.18e-22 SMART
LIM 269 320 4.37e-20 SMART
LIM 328 379 3.69e-18 SMART
LIM 387 438 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163553
Predicted Effect possibly damaging
Transcript: ENSMUST00000163609
AA Change: R220H

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133134
Gene: ENSMUSG00000030782
AA Change: R220H

DomainStartEndE-ValueType
low complexity region 11 44 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
LIM 116 167 5.18e-22 SMART
LIM 175 226 4.37e-20 SMART
LIM 234 285 3.69e-18 SMART
LIM 293 344 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164710
AA Change: R353H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130964
Gene: ENSMUSG00000030782
AA Change: R353H

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 28 48 N/A INTRINSIC
Pfam:Paxillin 49 178 1.4e-10 PFAM
low complexity region 197 209 N/A INTRINSIC
LIM 249 300 5.18e-22 SMART
LIM 308 359 4.37e-20 SMART
LIM 367 418 3.69e-18 SMART
LIM 426 477 6.89e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165667
AA Change: R292H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127695
Gene: ENSMUSG00000030782
AA Change: R292H

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 27 37 N/A INTRINSIC
low complexity region 83 116 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
LIM 188 239 5.18e-22 SMART
LIM 247 298 4.37e-20 SMART
LIM 306 357 3.69e-18 SMART
LIM 365 416 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166755
Predicted Effect possibly damaging
Transcript: ENSMUST00000167965
AA Change: R331H

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132100
Gene: ENSMUSG00000030782
AA Change: R331H

DomainStartEndE-ValueType
Pfam:Paxillin 34 200 7.3e-8 PFAM
LIM 227 278 5.18e-22 SMART
LIM 286 337 4.37e-20 SMART
LIM 345 396 3.69e-18 SMART
LIM 404 455 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168825
SMART Domains Protein: ENSMUSP00000132685
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
LIM 165 216 5.18e-22 SMART
LIM 224 275 4.37e-20 SMART
LIM 283 334 3.69e-18 SMART
LIM 342 393 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169919
SMART Domains Protein: ENSMUSP00000131705
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 44 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170115
SMART Domains Protein: ENSMUSP00000129958
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 17 112 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206691
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal response to wire injury of femoral arteries and increased VSMC apoptosis in response to wire injury or mechanical stress. Mice homozygous for a different knock-out allele show normal platelet integrin function both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Tgfb1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tgfb1i1 APN 7 128252521 missense probably damaging 1.00
IGL01919:Tgfb1i1 APN 7 128248482 splice site probably benign
IGL01996:Tgfb1i1 APN 7 128249292 splice site probably benign
IGL02527:Tgfb1i1 APN 7 128252562 splice site probably benign
IGL02596:Tgfb1i1 APN 7 128248896 start codon destroyed probably null 0.05
IGL03139:Tgfb1i1 APN 7 128249304 missense possibly damaging 0.79
R0114:Tgfb1i1 UTSW 7 128249494 missense probably damaging 1.00
R1833:Tgfb1i1 UTSW 7 128249498 splice site probably benign
R2508:Tgfb1i1 UTSW 7 128248913 unclassified probably null
R4695:Tgfb1i1 UTSW 7 128249176 missense probably damaging 1.00
R4756:Tgfb1i1 UTSW 7 128249399 missense probably damaging 1.00
R4853:Tgfb1i1 UTSW 7 128248668 nonsense probably null
R5024:Tgfb1i1 UTSW 7 128248217 start codon destroyed probably null 0.33
R5770:Tgfb1i1 UTSW 7 128248547 intron probably benign
R5839:Tgfb1i1 UTSW 7 128253365 makesense probably null
R6105:Tgfb1i1 UTSW 7 128248417 splice site probably null
R6178:Tgfb1i1 UTSW 7 128253345 missense probably damaging 0.98
R6310:Tgfb1i1 UTSW 7 128252837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTACAGGTCCACTTTTCTCC -3'
(R):5'- AATCATCACACCCTGGGCTC -3'

Sequencing Primer
(F):5'- ATAAGTTTTCTTCAATTCCATCTGGC -3'
(R):5'- ACACCCTGGGCTCCTAGC -3'
Posted On2014-09-18