Incidental Mutation 'R2116:Plppr3'
ID233176
Institutional Source Beutler Lab
Gene Symbol Plppr3
Ensembl Gene ENSMUSG00000035835
Gene Namephospholipid phosphatase related 3
SynonymsBC005764, Lppr3
MMRRC Submission 040120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79860475-79874634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79865738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 423 (D423E)
Ref Sequence ENSEMBL: ENSMUSP00000089979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000092325] [ENSMUST00000095457] [ENSMUST00000165601] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000166023] [ENSMUST00000167250] [ENSMUST00000167707] [ENSMUST00000167897] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092325
AA Change: D423E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089979
Gene: ENSMUSG00000035835
AA Change: D423E

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
coiled coil region 430 460 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165601
SMART Domains Protein: ENSMUSP00000128681
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 266 7.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166023
SMART Domains Protein: ENSMUSP00000127171
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166593
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167707
SMART Domains Protein: ENSMUSP00000132994
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Blast:acidPPc 125 159 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167897
SMART Domains Protein: ENSMUSP00000127972
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170910
Predicted Effect probably benign
Transcript: ENSMUST00000172282
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184090
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteins in the lipid phosphate phosphatase (LPP) family, including PRG2, are integral membrane proteins that modulate bioactive lipid phosphates including phosphatidate, lysophosphatidate, and sphingosine-1-phosphate in the context of cell migration, neurite retraction, and mitogenesis (Brauer et al., 2003 [PubMed 12730698]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Plppr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Plppr3 APN 10 79866669 missense probably damaging 1.00
IGL01108:Plppr3 APN 10 79867521 missense probably damaging 1.00
IGL01116:Plppr3 APN 10 79866923 missense probably damaging 1.00
IGL01362:Plppr3 APN 10 79865961 missense probably damaging 1.00
IGL03065:Plppr3 APN 10 79866046 missense probably benign 0.06
R0972:Plppr3 UTSW 10 79865086 missense probably damaging 0.99
R1508:Plppr3 UTSW 10 79867540 missense probably damaging 1.00
R1844:Plppr3 UTSW 10 79866410 critical splice donor site probably null
R1907:Plppr3 UTSW 10 79874069 missense probably damaging 1.00
R1982:Plppr3 UTSW 10 79866425 missense probably damaging 1.00
R1984:Plppr3 UTSW 10 79867460 nonsense probably null
R1985:Plppr3 UTSW 10 79867460 nonsense probably null
R2355:Plppr3 UTSW 10 79865360 missense possibly damaging 0.81
R4092:Plppr3 UTSW 10 79867480 missense probably damaging 1.00
R4572:Plppr3 UTSW 10 79866063 missense probably benign 0.03
R4685:Plppr3 UTSW 10 79867525 missense probably damaging 1.00
R4824:Plppr3 UTSW 10 79865673 missense possibly damaging 0.81
R5102:Plppr3 UTSW 10 79865386 missense possibly damaging 0.84
R5212:Plppr3 UTSW 10 79862445 missense probably benign 0.00
R5584:Plppr3 UTSW 10 79866452 missense probably damaging 1.00
R5684:Plppr3 UTSW 10 79865317 missense possibly damaging 0.81
R5778:Plppr3 UTSW 10 79866503 missense possibly damaging 0.78
R5954:Plppr3 UTSW 10 79866126 missense probably benign 0.05
R6306:Plppr3 UTSW 10 79861732 nonsense probably null
R6357:Plppr3 UTSW 10 79865406 missense probably benign 0.06
R7134:Plppr3 UTSW 10 79865703 missense not run
X0067:Plppr3 UTSW 10 79865284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCCTCAGGGATGTGTACGAG -3'
(R):5'- CATCTCTTGGCAGCCTGAAG -3'

Sequencing Primer
(F):5'- CCTTGGAGGCAGGATGAC -3'
(R):5'- CAGCGTGGATGTGGACCTG -3'
Posted On2014-09-18