Incidental Mutation 'R2116:Adamts20'
ID233200
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission 040120-MU
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94355362 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 377 (C377R)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect probably damaging
Transcript: ENSMUST00000035342
AA Change: C377R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: C377R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129195
Predicted Effect probably damaging
Transcript: ENSMUST00000155907
AA Change: C377R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: C377R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2105E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably benign Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably benign Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q949L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L318Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I198T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 K165E noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably benign Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably benign
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably benign
IGL03088:Adamts20 APN 15 94329914 unclassified probably benign
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 splice acceptor site
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site silent
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably benign
R6417:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably benign
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- AAGGACCACAGTAGCCTTTC -3'
(R):5'- TCAGTGAAAGCCATTTAGTCTGTTC -3'

Sequencing Primer
(F):5'- TTTCAAGGATGAAGGATGAAAATCAC -3'
(R):5'- CACCAGTGACTGGTTTAC -3'
Posted OnSep 18, 2014