Incidental Mutation 'R2116:Mta2'
ID233214
Institutional Source Beutler Lab
Gene Symbol Mta2
Ensembl Gene ENSMUSG00000071646
Gene Namemetastasis-associated gene family, member 2
SynonymsMta1l1, mmta2
MMRRC Submission 040120-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8941875-8952303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8943516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 27 (I27T)
Ref Sequence ENSEMBL: ENSMUSP00000093959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096240] [ENSMUST00000096241] [ENSMUST00000224272]
Predicted Effect probably damaging
Transcript: ENSMUST00000096240
AA Change: I27T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646
AA Change: I27T

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096241
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169535
Predicted Effect probably benign
Transcript: ENSMUST00000224272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226096
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit partial embryonic and perinatal lethality, reduced weight, shortened lifespan, and increased susceptibility to systemic lupus erythematosus with increased T cell proliferation under Th2 conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mfsd6 T A 1: 52,660,975 R671S probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Mta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Mta2 APN 19 8947101 missense probably benign 0.23
IGL01098:Mta2 APN 19 8946717 missense probably damaging 0.98
IGL01148:Mta2 APN 19 8948304 missense probably damaging 0.98
IGL01897:Mta2 APN 19 8947766 nonsense probably null
IGL02054:Mta2 APN 19 8950912 missense probably benign
IGL02157:Mta2 APN 19 8947249 splice site probably benign
IGL02452:Mta2 APN 19 8950306 missense probably benign 0.00
IGL02563:Mta2 APN 19 8948051 missense probably benign
IGL02626:Mta2 APN 19 8949168 missense probably damaging 1.00
IGL02695:Mta2 APN 19 8948364 missense probably benign 0.01
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1301:Mta2 UTSW 19 8949186 splice site probably benign
R1731:Mta2 UTSW 19 8947724 splice site probably null
R1990:Mta2 UTSW 19 8942332 unclassified probably benign
R2117:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R4614:Mta2 UTSW 19 8948128 splice site probably null
R4710:Mta2 UTSW 19 8949153 missense probably damaging 1.00
R4801:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4802:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4947:Mta2 UTSW 19 8946291 missense possibly damaging 0.68
R4999:Mta2 UTSW 19 8950383 missense probably benign
R5340:Mta2 UTSW 19 8942356 start codon destroyed probably null 0.89
R5518:Mta2 UTSW 19 8948092 missense probably benign 0.01
R6044:Mta2 UTSW 19 8948331 missense probably damaging 0.99
R7096:Mta2 UTSW 19 8947775 missense not run
Predicted Primers PCR Primer
(F):5'- TTTTGAGGCAGGTTTCCCC -3'
(R):5'- GCGCAGAGTCAAAAGCAATATC -3'

Sequencing Primer
(F):5'- TGAACCAAGAGCCTGCTTTG -3'
(R):5'- CTCCTTAAGGGTCTAAGTAGAAGAGC -3'
Posted On2014-09-18