Incidental Mutation 'R2099:Carmil1'
ID233262
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 040103-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2099 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24173667 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 66 (L66F)
Ref Sequence ENSEMBL: ENSMUSP00000106028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000123076] [ENSMUST00000140042]
Predicted Effect probably benign
Transcript: ENSMUST00000072889
AA Change: L66F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: L66F

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110398
AA Change: L66F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: L66F

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136517
Predicted Effect probably benign
Transcript: ENSMUST00000140042
SMART Domains Protein: ENSMUSP00000127121
Gene: ENSMUSG00000021338

DomainStartEndE-ValueType
PDB:4K17|D 1 58 3e-33 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,506,894 R14Q unknown Het
Aga C A 8: 53,521,131 Y286* probably null Het
Anks1 T C 17: 27,978,491 probably null Het
Arih2 A T 9: 108,616,738 F159I probably damaging Het
Asxl1 A T 2: 153,352,267 M46L possibly damaging Het
Atp23 G T 10: 126,891,726 probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cramp1l A G 17: 24,973,085 V1027A probably benign Het
Cx3cr1 G A 9: 120,052,273 A21V probably benign Het
D3Ertd254e C T 3: 36,164,212 T128I possibly damaging Het
Dcxr A G 11: 120,725,577 F221S probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dnah2 T C 11: 69,493,237 D1051G probably damaging Het
Ehbp1l1 T C 19: 5,718,401 E958G possibly damaging Het
Eif3a C A 19: 60,764,113 probably benign Het
Ephb2 T C 4: 136,660,755 D678G probably damaging Het
Fam109a C T 5: 121,853,286 P237L possibly damaging Het
Fpr3 G T 17: 17,971,181 R238L probably damaging Het
Frem3 A G 8: 80,615,859 S1594G probably benign Het
Gbp4 A C 5: 105,121,081 L402W probably damaging Het
Gdpd5 T A 7: 99,448,489 L164Q probably damaging Het
Il4i1 T C 7: 44,838,192 probably null Het
Kcp G T 6: 29,496,165 C723* probably null Het
Klhl18 A G 9: 110,455,418 F2L probably damaging Het
Lepr T A 4: 101,772,988 D633E probably damaging Het
Lifr A G 15: 7,157,251 I79V probably benign Het
Mcrs1 A G 15: 99,249,946 S27P probably benign Het
Mmp3 A G 9: 7,453,672 D431G probably benign Het
Mtor T A 4: 148,550,192 Y2423* probably null Het
Ndc80 A T 17: 71,504,778 D484E probably benign Het
Ndufb8 T A 19: 44,555,310 probably benign Het
Nmur2 A T 11: 56,040,763 S41T probably benign Het
Notch2 T C 3: 98,115,321 C819R possibly damaging Het
Olfr1303 A G 2: 111,813,832 I298T probably benign Het
Olfr781 A T 10: 129,333,283 N134I probably damaging Het
Olfr958 A G 9: 39,550,667 V68A probably benign Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Samd7 T C 3: 30,756,560 V242A probably benign Het
Sde2 T C 1: 180,866,148 L401P probably damaging Het
Slc20a1 A G 2: 129,207,838 D340G probably benign Het
Slc2a5 T A 4: 150,143,177 Y484* probably null Het
Spata31d1a A G 13: 59,706,071 L27P probably damaging Het
Sqstm1 T C 11: 50,202,984 T269A possibly damaging Het
Syne2 T C 12: 75,979,973 V3525A probably benign Het
Tctn1 G A 5: 122,242,709 P512L probably damaging Het
Tlr1 A G 5: 64,925,068 F722S probably damaging Het
Treh A G 9: 44,684,646 Y376C probably damaging Het
Trim47 T C 11: 116,106,344 N529S probably damaging Het
Trrap T C 5: 144,782,239 V184A possibly damaging Het
Tyrp1 T A 4: 80,835,379 N102K possibly damaging Het
Uspl1 T A 5: 149,214,758 S724T probably damaging Het
Vmn2r2 C A 3: 64,117,053 K702N probably damaging Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGCTTTTCAGTTGTGTCAGAAAG -3'
(R):5'- AAGCCCAGGTCTGTTATGGTG -3'

Sequencing Primer
(F):5'- TTCAGTTGTGTCAGAAAGAAAGAAAG -3'
(R):5'- TGGACCGAGGTTACCAAGC -3'
Posted On2014-09-18